dbf4

Ensembl ID:
ENSDARG00000074796
ZFIN ID:
ZDB-GENE-091020-13
Description:
DBF4 homolog [Source:RefSeq peptide;Acc:NP_001128607]
Human Orthologue:
DBF4
Human Description:
DBF4 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17364]
Mouse Orthologue:
Dbf4
Mouse Description:
DBF4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1351328]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9288 Nonsense Mutation detected in F1 DNA During 2017
sa22931 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065643 Nonsense 265 612 9 12
Genomic Location (Zv9):
Chromosome 16 (position 45988810)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43242103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTTGATGGAGGAACAGGGAAAGGATGACCCAAAGAAGAAACAAAAAGAA[C/T]AAAGGTAGAGCAGAGTCAGTAACAYACCCTATTGAAATCCTCAAGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065643 Essential Splice Site 306 612 10 12
Genomic Location (Zv9):
Chromosome 16 (position 45989026)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43242319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGGTACTGTGAGTGCTGCGAGGTCAAATTTGAAAACTTAAAGGCGG[T/C]ATGTGTCAAAATAGAAAGCCACTTTTAATTGAAAATCAAATAGAATAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link