LOC100000026

Ensembl ID:
ENSDARG00000074791
Human Orthologues:
ALDH3A1, ALDH3A2
Human Descriptions:
aldehyde dehydrogenase 3 family, member A1 [Source:HGNC Symbol;Acc:405]
aldehyde dehydrogenase 3 family, member A2 [Source:HGNC Symbol;Acc:403]
Mouse Orthologues:
Aldh3a1, Aldh3a2
Mouse Descriptions:
aldehyde dehydrogenase family 3, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1353451]
aldehyde dehydrogenase family 3, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:1353452]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa953 Nonsense F2 line generated During 2014
sa13393 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa953
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112805 Nonsense 64 527 2 10
Genomic Location:
Chromosome 15 (position 19762996)
KASP Assay ID:
554-0858.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGGGAGGTCTTCCAGTCAGGCAGATCCAGACCCCTGCAGTACAGAAAA[C/T]AGCAGCTTAGAGCTCTGCTCCGGCTCATCACTGAACGCCATGCAGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112805 Essential Splice Site 352 527 7 10
Genomic Location:
Chromosome 15 (position 19765500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACCATTGCTTTGGGAGGAGAAAATGATCGCKCACAGTGTTACATAG[G/A]TAAAGGCAACTTTTGTTGGCACTGATAAAAAATGTTTCATTKGGTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/21tv2nb8