LOC100000026

Ensembl ID:
ENSDARG00000074791
Human Orthologues:
ALDH3A1, ALDH3A2
Human Descriptions:
aldehyde dehydrogenase 3 family, member A1 [Source:HGNC Symbol;Acc:405]
aldehyde dehydrogenase 3 family, member A2 [Source:HGNC Symbol;Acc:403]
Mouse Orthologues:
Aldh3a1, Aldh3a2
Mouse Descriptions:
aldehyde dehydrogenase family 3, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1353451]
aldehyde dehydrogenase family 3, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:1353452]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa953 Nonsense F2 line generated During 2016
sa35868 Nonsense Available for shipment Available now
sa13393 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa953
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112805 Nonsense 64 527 2 10
Genomic Location (Zv9):
Chromosome 15 (position 19762996)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20865622
KASP Assay ID:
554-0858.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGGGAGGTCTTCCAGTCAGGCAGATCCAGACCCCTGCAGTACAGAAAA[C/T]AGCAGCTTAGAGCTCTGCTCCGGCTCATCACTGAACGCCATGCAGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112805 Nonsense 159 527 3 10
Genomic Location (Zv9):
Chromosome 15 (position 19763366)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20865992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGTGTTGATTATTGGAACCTGGAACTATCCTTGGGCCATGATCTTT[C/T]AGCCCCTTGTTGGAGCTATTGCAGCTGGTAATGGAATTCTTTTTAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112805 Essential Splice Site 352 527 7 10
Genomic Location (Zv9):
Chromosome 15 (position 19765500)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20868126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACCATTGCTTTGGGAGGAGAAAATGATCGCKCACAGTGTTACATAG[G/A]TAAAGGCAACTTTTGTTGGCACTGATAAAAAATGTTTCATTKGGTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link