si:ch73-138e16.6

Ensembl ID:
ENSDARG00000074789
ZFIN ID:
ZDB-GENE-070705-205
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WWL3]
Human Orthologues:
ZFP112, ZNF155, ZNF214, ZNF222, ZNF223, ZNF224, ZNF226, ZNF227, ZNF229, ZNF230, ZNF233, ZNF234, ZNF235, ZNF239, ZNF284, ZNF285, ZNF45, ZNF664
Human Descriptions:
zinc finger protein 112 homolog (mouse) [Source:HGNC Symbol;Acc:13021]
zinc finger protein 155 [Source:HGNC Symbol;Acc:12940]
zinc finger protein 214 [Source:HGNC Symbol;Acc:13006]
zinc finger protein 222 [Source:HGNC Symbol;Acc:13015]
zinc finger protein 223 [Source:HGNC Symbol;Acc:13016]
zinc finger protein 224 [Source:HGNC Symbol;Acc:13017]
zinc finger protein 226 [Source:HGNC Symbol;Acc:13019]
zinc finger protein 227 [Source:HGNC Symbol;Acc:13020]
zinc finger protein 229 [Source:HGNC Symbol;Acc:13022]
zinc finger protein 230 [Source:HGNC Symbol;Acc:13024]
zinc finger protein 233 [Source:HGNC Symbol;Acc:30946]
zinc finger protein 234 [Source:HGNC Symbol;Acc:13027]
zinc finger protein 235 [Source:HGNC Symbol;Acc:12866]
zinc finger protein 239 [Source:HGNC Symbol;Acc:13031]
zinc finger protein 284 [Source:HGNC Symbol;Acc:13078]
zinc finger protein 285 [Source:HGNC Symbol;Acc:13079]
zinc finger protein 45 [Source:HGNC Symbol;Acc:13111]
zinc finger protein 664 [Source:HGNC Symbol;Acc:25406]
Mouse Orthologues:
Zfp108, Zfp109, Zfp111, Zfp112, Zfp114, Zfp235, Zfp239, Zfp61, Zfp664, Zfp93, Zfp94
Mouse Descriptions:
zinc finger protein 108 Gene [Source:MGI Symbol;Acc:MGI:1891198]
zinc finger protein 109 Gene [Source:MGI Symbol;Acc:MGI:1929099]
zinc finger protein 111 Gene [Source:MGI Symbol;Acc:MGI:1929114]
zinc finger protein 112 Gene [Source:MGI Symbol;Acc:MGI:1929115]
zinc finger protein 114 Gene [Source:MGI Symbol;Acc:MGI:3037815]
zinc finger protein 235 Gene [Source:MGI Symbol;Acc:MGI:1929117]
zinc finger protein 239 Gene [Source:MGI Symbol;Acc:MGI:1306812]
zinc finger protein 61 Gene [Source:MGI Symbol;Acc:MGI:99663]
zinc finger protein 664 Gene [Source:MGI Symbol;Acc:MGI:2442505]
zinc finger protein 93 Gene [Source:MGI Symbol;Acc:MGI:107611]
zinc finger protein 94 Gene [Source:MGI Symbol;Acc:MGI:107610]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24055 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106529 Nonsense 85 473 2 3
ENSDART00000142151 Nonsense 85 240 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2492757)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1305605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCGTACACGTGTACCGTGTGTGGGAAGAGTTTCAGACAGTCGGCATA[C/A]CTTAATCAACACATGATGATCCACACCGGAGAGAAGCCACACAAATGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link