GPR97

Ensembl ID:
ENSDARG00000074782
Description:
G protein-coupled receptor 97 [Source:HGNC Symbol;Acc:13728]
Human Orthologue:
GPR97
Human Description:
G protein-coupled receptor 97 [Source:HGNC Symbol;Acc:13728]
Mouse Orthologue:
Gpr97
Mouse Description:
G protein-coupled receptor 97 Gene [Source:MGI Symbol;Acc:MGI:1859670]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34227 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16663 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114592 Essential Splice Site 21 518 2 12
Genomic Location (Zv9):
Chromosome 7 (position 66793808)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64708882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGTTAGGAGTGAATATAAAAACTAATTACCTCCATGATTTGACATCA[G/A]TTTACAGAAAACCTACATGCCATTCAGTTCTGGACAATTGTATGAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114592 Nonsense 423 518 11 12
Genomic Location (Zv9):
Chromosome 7 (position 66807233)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 64722307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGCAGTGRTTGTRGTAAAGWTGCGTCAGTTAAGACAGCAGAATRTA[C/T]AAATAGACCATCAGAAGAGGGCRTGGAAAGACTGCGTGTCTCTGCTGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link