C7U123_DANRE

Ensembl ID:
ENSDARG00000074781
Description:
RPTP-rho [Source:UniProtKB/TrEMBL;Acc:C7U123]
Human Orthologue:
PTPRT
Human Description:
protein tyrosine phosphatase, receptor type, T [Source:HGNC Symbol;Acc:9682]
Mouse Orthologue:
Ptprt
Mouse Description:
protein tyrosine phosphatase, receptor type, T Gene [Source:MGI Symbol;Acc:MGI:1321152]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11104 Nonsense Available for shipment Available now
sa7050 Nonsense Mutation detected in F1 DNA During 2014
sa15512 Nonsense Available for shipment Available now
sa17989 Nonsense Available for shipment Available now
sa15571 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 378 1496 7 34
Genomic Location:
Chromosome 6 (position 51228137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGGAGGGCGGCACTGGACCACCAGGACCACCGCTTATAACTCGCACC[A/T]AATGTGCTGGTAAGTGTCTATATACAGTACAGTACATACTTTGAGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 634 1496 12 34
Genomic Location:
Chromosome 6 (position 51146546)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWAGTTCTTATCAAGTGGTGGTTCAGGAGGAGCGRAAGCAGAAAGTCCGG[C/T]GAGCCACTGATGTTCTGGAGTGTTTCCCTGTTCCCGTGAGCTTCAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 831 1496 17 34
Genomic Location:
Chromosome 6 (position 51084132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCCGTAGGCACAGCGGATAAAAGCACAGGAAAAGTCAGCACATTACAC[A/T]AGGACGATCCGYTCTCCACCAGCAACCAGGACCTCAACGGATTCTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 None None 237 None 9
ENSDART00000108571 Nonsense 1027 1496 24 34
Genomic Location:
Chromosome 6 (position 51016175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCTTGTCTCCTGTAGGCCCCATGCAGGAGACCGTCAGGGATTTCTG[G/A]AGRATGATTTGGCAGGAGAATTCAGCCAGTATCGTCATGGTAACCAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092493 Nonsense 216 237 7 9
ENSDART00000108571 Nonsense 1427 1496 32 34
Genomic Location:
Chromosome 6 (position 50975530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGTCAGACGACTGGCCAAATGGCARGAGCAGTATGAYGGAGGAGAT[G/T]GACGTACAGTCGTCCACTGCCTGTGAGTCTGACCTCCACCACACACAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4lmetcjh