si:ch211-263m18.3

Ensembl ID:
ENSDARG00000074777
ZFIN ID:
ZDB-GENE-091113-6
Mouse Orthologue:
Ank1
Mouse Description:
ankyrin 1, erythroid Gene [Source:MGI Symbol;Acc:MGI:88024]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37288 Nonsense Mutation detected in F1 DNA During 2017
sa917 Essential Splice Site Available for shipment Available now
sa15660 Nonsense Available for shipment Available now
sa18669 Essential Splice Site Available for shipment Available now
sa37287 Nonsense Mutation detected in F1 DNA During 2017
sa12882 Nonsense Available for shipment Available now
sa37286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065998 Nonsense 215 1923 6 42
ENSDART00000144361 Nonsense 186 1672 5 41

The following transcripts of ENSDARG00000074777 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19907666)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21043155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATGGCACCAAAGGAAAAGTGCGTCTGCCGGCTCTACATATCGCAGCA[C/T]GAAACGACGACACACGCACCGCTGCCGTACTCCTCCAGAACGACCCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065998 Essential Splice Site 765 1923 19 42
ENSDART00000144361 Essential Splice Site 733 1672 18 41

The following transcripts of ENSDARG00000074777 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19893064)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21028553
KASP Assay ID:
554-0823.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAAGTTCTTACTCCAGCAGCAAGCWCACGTAAACAGCAAGACAAGAG[T/C]AAGTGTTCTACTTCTGGATGCATCATACACAGGCCTTTTCAGTGTTNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065998 Nonsense 914 1923 24 42
ENSDART00000144361 Nonsense 853 1672 23 41

The following transcripts of ENSDARG00000074777 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19885226)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21020715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCWCCTGCRATTCCCAGAATTCCATGCGTGTCACCTGAAACTGTCATGT[T/A]GGACCAGGTAKAGTTGTTTTCTGTGTTATGTGCTGTAATAAGAAWTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065998 Essential Splice Site 1220 1923 29 42
ENSDART00000144361 Essential Splice Site 1159 1672 28 41

The following transcripts of ENSDARG00000074777 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19877171)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21012660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAGAGGGGGACRCCACCAGYCTCCGMCTCCTCTGCAGTGTTATTGG[T/A]ACAGTCCGAYTCTCATYCATTTCAAAGCAAACATTRTYTGAAAATGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065998 Nonsense 1377 1923 33 42
ENSDART00000144361 Nonsense 1320 1672 32 41

The following transcripts of ENSDARG00000074777 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19872113)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21007602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCTCTGCCTCTCCATTTCCCCTGGCTCGTCAGGTGAGAGATGCTAAT[A/T]AGGAAGCCAGTGGGTTCCTGTCCTTCCTACGCAAGTCCACCAAGTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065998 Nonsense 1699 1923 38 42
ENSDART00000144361   None 1672 None 41

The following transcripts of ENSDARG00000074777 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19856951)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20992440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGACGACATACAGCACGAGCCGGTGTCTGCRAGTGCAGAAAAAGCATG[G/A]GCCAGCGGTGCYGTCCCAAAGGCTAACTATAATGGGCAGGCTGGAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065998 Nonsense 1819 1923 39 42
ENSDART00000144361 Nonsense 1568 1672 38 41

The following transcripts of ENSDARG00000074777 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19856302)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20991791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAGGCAGACCATGGAGACCATGATGTCATCGTCCCCGGACCACAAT[C/T]AGTCACGTGTAGCACAGGAGGCCCTGCTTACACCGGTATGTGATACAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link