crfb17

Ensembl ID:
ENSDARG00000074771
ZFIN ID:
ZDB-GENE-081022-158
Description:
interferon gamma receptor 1 [Source:RefSeq peptide;Acc:NP_001129451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7918 Nonsense Mutation detected in F1 DNA During 2014
sa1747 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114506 Nonsense 77 384 3 7
Genomic Location:
Chromosome 1 (position 54420463)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTANNNNNTAATGTTTTATTTGTGTTCCAGGAAACGTGATGAGACGACAAAT[C/T]GATTTCTWAACATATCCAGATTGCTGTCTCGAGCAGCGTATAATGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114506 Nonsense 101 384 3 7
Genomic Location:
Chromosome 1 (position 54420537)
KASP Assay ID:
554-1740.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCTCGAGCAGCGTATAATGACTATAATGTGACTGTGAAGGCATTATG[G/A]AACGAACATAGGTTAATATCGTCCTCGTCAATTCAATTCACCTTCAATCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3a5rrj0k