crfb17

Ensembl ID:
ENSDARG00000074771
ZFIN ID:
ZDB-GENE-081022-158
Description:
interferon gamma receptor 1 [Source:RefSeq peptide;Acc:NP_001129451]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7918 Nonsense Mutation detected in F1 DNA During 2016
sa39701 Nonsense Mutation detected in F1 DNA During 2016
sa1747 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114506 Nonsense 77 384 3 7
Genomic Location:
Chromosome 1 (position 54420463)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTANNNNNTAATGTTTTATTTGTGTTCCAGGAAACGTGATGAGACGACAAAT[C/T]GATTTCTWAACATATCCAGATTGCTGTCTCGAGCAGCGTATAATGACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114506 Nonsense 87 384 3 7
Genomic Location:
Chromosome 1 (position 54420493)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTGATGAGACGACAAATCGATTTCTAAACATATCCAGATTGCTGTCT[C/T]GAGCAGCGTATAATGACTATAATGTGACTGTGAAGGCATTATGGAACGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114506 Nonsense 101 384 3 7
Genomic Location:
Chromosome 1 (position 54420537)
KASP Assay ID:
554-1740.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCTCGAGCAGCGTATAATGACTATAATGTGACTGTGAAGGCATTATG[G/A]AACGAACATAGGTTAATATCGTCCTCGTCAATTCAATTCACCTTCAATCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link