si:ch211-93n23.6

Ensembl ID:
ENSDARG00000074760
ZFIN IDs:
ZDB-GENE-010319-27, ZDB-GENE-081028-67
Description:
Novel protein similar to vertebrate tetratricopeptide repeat domain 7 family [Source:UniProtKB/TrEMB
Human Orthologue:
TTC7A
Human Description:
tetratricopeptide repeat domain 7A [Source:HGNC Symbol;Acc:19750]
Mouse Orthologue:
Ttc7
Mouse Description:
tetratricopeptide repeat domain 7 Gene [Source:MGI Symbol;Acc:MGI:1920999]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22223 Nonsense Available for shipment Available now
sa2679 Nonsense Available for shipment Available now
sa38921 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42138 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109059 Nonsense 96 885 3 21
ENSDART00000138448 Nonsense 96 877 3 21
Genomic Location (Zv9):
Chromosome 13 (position 8062347)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8366867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATGATTACAGGACGCTGCTGCTGGCCGAAGCGCTGCTGGAGGAATG[T/A]CTGCTGGAGAACATGACCCTACTGAAGAATTCTACTCCTCTGACCGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109059 Nonsense 182 885 4 21
ENSDART00000138448 Nonsense 182 877 4 21
Genomic Location (Zv9):
Chromosome 13 (position 8064990)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8369510
KASP Assay ID:
554-2520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGGGAGTCGATGAWTTCACCCACCAGGACCAGCCTGTCTACCAACTA[C/T]GAATGTTGGCAGAAGCTTTTGTCATCAAAGGTATGAACTAATGTATCAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109059 Essential Splice Site 455 885 11 21
ENSDART00000138448 Essential Splice Site 455 877 11 21
Genomic Location (Zv9):
Chromosome 13 (position 8084877)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8389397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCATCTTTGGTATCAGCTTGGCTTGTCATTAATGGCAAGTGGGAAGG[T/C]GAGATTGCTGACATCATTATGCTTCTATTGATTTATTAGTCATTTGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109059 Essential Splice Site 666 885 18 21
ENSDART00000138448 Essential Splice Site 666 877 18 21
Genomic Location (Zv9):
Chromosome 13 (position 8102340)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8406860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTATTAGATGAAGTGAATTCATATTTTCTTCTCTTTTTC[A/G]GTGAAGAAGATGACTCTAATAGCATACCTCCTGAACCAGGCCCACTGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link