si:ch211-261n11.2

Ensembl ID:
ENSDARG00000074758
ZFIN ID:
ZDB-GENE-030131-8623
Human Orthologue:
CSDE1
Human Description:
cold shock domain containing E1, RNA-binding [Source:HGNC Symbol;Acc:29905]
Mouse Orthologue:
Csde1
Mouse Description:
cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41189 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112085 Essential Splice Site 566 817 12 18
ENSDART00000134542 Essential Splice Site 547 798 14 20
ENSDART00000140606 Essential Splice Site 357 377 7 8
ENSDART00000144041   None 278 None 8

The following transcripts of ENSDARG00000074758 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23133482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22504658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCATAGAAACAGCCAATCACGATCAGGAGATCTTCTTCCACTACAG[G/A]TGTGAAACTCTCCTGCTTGATTTTGACTTGTGTGGTGGTGTTTTTGTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link