tfb2m

Ensembl ID:
ENSDARG00000074756
ZFIN ID:
ZDB-GENE-070521-3
Description:
dimethyladenosine transferase 2, mitochondrial [Source:RefSeq peptide;Acc:NP_001107089]
Human Orthologue:
TFB2M
Human Description:
transcription factor B2, mitochondrial [Source:HGNC Symbol;Acc:18559]
Mouse Orthologues:
AC122891.1, Tfb2m
Mouse Description:
transcription factor B2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:107937]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10078 Nonsense Available for shipment Available now
sa2933 Nonsense F2 line generated During 2016
sa36345 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110058 Nonsense 219 437 4 10
Genomic Location (Zv9):
Chromosome 17 (position 11927598)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11910120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCCCCGTCATGTACTCAGAAAAGCTCTTCTCTGACCTTGCCATCTCW[G/T]AAGTACCGTGGACAGCAGGTTAGTGAACCAAACATTCAGAATAATATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2933
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110058 Nonsense 333 437 8 10
ENSDART00000110058 Nonsense 333 437 8 10
Genomic Location (Zv9):
Chromosome 17 (position 11935696)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11918218
KASP Assay ID:
554-3434.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATATACTTTTTTTTTTTTGAACAGCTATCCCAGAGTGAAAACCTTTG[T/A]CTGGTGCGKATCACCCCACGCGAGGACTTGTTTAGCTCTCATTTAACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110058 Nonsense 425 437 9 10
Genomic Location (Zv9):
Chromosome 17 (position 11936240)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11918762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTGAGCTGATGGAACAGTCTGGAAGCTTCGCTGAGAGCTGGCTTTA[T/A]CAGGAGACGCTGGAAACCACAAAAATAGGCCACGGTTAACACCACCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link