tfb2m

Ensembl ID:
ENSDARG00000074756
ZFIN ID:
ZDB-GENE-070521-3
Description:
dimethyladenosine transferase 2, mitochondrial [Source:RefSeq peptide;Acc:NP_001107089]
Human Orthologue:
TFB2M
Human Description:
transcription factor B2, mitochondrial [Source:HGNC Symbol;Acc:18559]
Mouse Orthologues:
AC122891.1, Tfb2m
Mouse Description:
transcription factor B2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:107937]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10078 Nonsense Available for shipment Available now
sa2933 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa10078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110058 Nonsense 219 437 4 10
Genomic Location:
Chromosome 17 (position 11927598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCCCCGTCATGTACTCAGAAAAGCTCTTCTCTGACCTTGCCATCTCW[G/T]AAGTACCGTGGACAGCAGGTTAGTGAACCAAACATTCAGAATAATATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2933
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110058 Nonsense 333 437 8 10
ENSDART00000110058 Nonsense 333 437 8 10
Genomic Location:
Chromosome 17 (position 11935696)
KASP Assay ID:
554-3434.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATATACTTTTTTTTTTTTGAACAGCTATCCCAGAGTGAAAACCTTTG[T/A]CTGGTGCGKATCACCCCACGCGAGGACTTGTTTAGCTCTCATTTAACTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cnh5uzqh