QSER1

Ensembl ID:
ENSDARG00000074750
Description:
glutamine and serine rich 1 [Source:HGNC Symbol;Acc:26154]
Human Orthologue:
QSER1
Human Description:
glutamine and serine rich 1 [Source:HGNC Symbol;Acc:26154]
Mouse Orthologue:
Qser1
Mouse Description:
glutamine and serine rich 1 Gene [Source:MGI Symbol;Acc:MGI:2138986]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23375 Nonsense Available for shipment Available now
sa29095 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109948 Nonsense 724 1708 4 13
Genomic Location (Zv9):
Chromosome 18 (position 44099469)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45688524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAATGCACTCCTCCACCCTTGCACCCTTGAGTGCTGATCAGCTGAAA[C/T]AGCATACTTTACTTCTGAAAGGGTCCAGTTCTCAGCAGCAGAACCATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109948 Nonsense 1072 1708 4 13
Genomic Location (Zv9):
Chromosome 18 (position 44100513)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45689568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCAATGATAGTATCATTGAAAATTCAACTGATGGCCTTGCAAAAAAA[C/T]GATCCAGATCAAAGGGTTCATCCAAGCAGACTGCTGAAGATGAAAATGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link