abca12

Ensembl ID:
ENSDARG00000074749
ZFIN ID:
ZDB-GENE-030131-9790
Description:
Novel protein similar to vertebrate ATP-binding cassette, sub-family A (ABC1) family [Source:UniProt
Human Orthologue:
ABCA12
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 12 [Source:HGNC Symbol;Acc:14637]
Mouse Orthologue:
Abca12
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 12 Gene [Source:MGI Symbol;Acc:MGI:2676312]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18961 Nonsense Mutation detected in F1 DNA During 2016
sa9840 Nonsense Available for shipment Available now
sa2502 Nonsense F2 line generated During 2016
sa41498 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34715 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197   None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
ENSDART00000109197   None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
Genomic Location (Zv9):
Chromosome 9 (position 41833750)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40958920
KASP Assay ID:
2260-2246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGCGAACATGACAGTCCTGTTAGAGAAAAACAAGTTTATCATGGAC[C/T]AGATCACCACCCTCTCTGTGCTCATGATGAACCTCTCCTCCTGTGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197   None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
ENSDART00000109197   None 674 None 16
ENSDART00000138634 Nonsense 133 1809 4 36
Genomic Location (Zv9):
Chromosome 9 (position 41833750)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40958920
KASP Assay ID:
2260-2246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAGCGAACATGACAGTCCTGTTAGAGAAAAACAAGTTTATCATGGAC[C/T]AGATCACCACCCTCTCTGTGCTCATGATGAACCTCTCCTCCTGYGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2502
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Nonsense 5 674 1 16
ENSDART00000138634 Nonsense 1116 1809 21 36
Genomic Location (Zv9):
Chromosome 9 (position 41794411)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40919581
KASP Assay ID:
554-3014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAGGATTAATTTATGCTTTTTTNGTGCTTTGTTTCAGATATGGAGGCT[G/A]GGAGTTTGGAAAGCCTCTTCCCATTGATCTTAAGATGGACATGTTAGAYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Essential Splice Site 30 674 None 16
ENSDART00000138634 Essential Splice Site 1141 1809 None 36
Genomic Location (Zv9):
Chromosome 9 (position 41794333)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40919503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTAAGATGGACATGTTAGATGTGCCAGCAAACAGAACCCTTAGTAAGG[T/A]AATTTGGATGAGTGATATAACATTGCCCCAATGGCAAAGTGGCTCATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109197 Nonsense 346 674 8 16
ENSDART00000138634 Nonsense 1462 1809 28 36
Genomic Location (Zv9):
Chromosome 9 (position 41778011)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 40903181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTAATGAAGATGAAGATGTGCTGGATGAACGTCTGCGTGTGGGCCGT[G/T]GAGATGCAAGCTCTGATATTCTGCAGGTTAATCACCTGACTAAGGTGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link