ENSDARG00000074748

Ensembl ID:
ENSDARG00000074748
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38366 Nonsense Mutation detected in F1 DNA During 2016
sa33079 Nonsense Mutation detected in F1 DNA During 2016
sa13123 Nonsense Available for shipment Available now
sa13108 Nonsense Available for shipment Available now
sa39975 Nonsense Mutation detected in F1 DNA During 2016
sa25979 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 279 1538 1 3
Genomic Location:
Chromosome 3 (position 4607168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGAGGATCCTCACTGAGATGGCCTCAGTCAATGTGCTTCTACTTCCA[C/T]AGCTTGATAGAAATGACAAACATGCAACGACAATTCAAAAACTGTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 1056 1538 1 3
Genomic Location:
Chromosome 3 (position 4609501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAAGTCCTCCTCAGTGATGTCTATAAAAGTGCCTCTTTAGGTCACTG[G/A]AGTGACAGCAGGGACATTTCTATTGAGCAGAACTTTTCTGAATATGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 1099 1538 1 3
ENSDART00000099237 Nonsense 1099 1538 1 3
Genomic Location:
Chromosome 3 (position 4609628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGATGTTACAGACCAATCATTGTCTTCAGAGGATGAGACACAAATA[C/T]GAGCATTAGTCTTAGGKATTGTTGAGGAGACAGAAAGAACGATTCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 1099 1538 1 3
ENSDART00000099237 Nonsense 1099 1538 1 3
Genomic Location:
Chromosome 3 (position 4609628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGATGTTACAGACCAATCATTGTCTTCAGAGGATGAGACACAAATA[C/T]GAGCATTAGTCTTAGGKATTGTTGAGGAGACAGAAAGAACGATTCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 1142 1538 1 3
Genomic Location:
Chromosome 3 (position 4609759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTACATTCAACAACTTACCAGTGACATCAAGACAAGAGTAACAAAATA[T/A]CAGGAAGGAGCAGTGAAATATAAGTTCAAGAACGAATTCTTCATTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 1337 1538 1 3
Genomic Location:
Chromosome 3 (position 4610343)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACATCAATCTACTGAACATGTTCAAGTCAACAGTGGAGATGTTGGTT[T/A]GTGGTTGAAGAGTTTCACACAGCAGCTCTCAGATCAGCTGATCTTCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link