ENSDARG00000074748

Ensembl ID:
ENSDARG00000074748
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13123 Nonsense Available for shipment Available now
sa13108 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 1099 1538 1 3
ENSDART00000099237 Nonsense 1099 1538 1 3
Genomic Location:
Chromosome 3 (position 4609628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGATGTTACAGACCAATCATTGTCTTCAGAGGATGAGACACAAATA[C/T]GAGCATTAGTCTTAGGKATTGTTGAGGAGACAGAAAGAACGATTCTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099237 Nonsense 1099 1538 1 3
ENSDART00000099237 Nonsense 1099 1538 1 3
Genomic Location:
Chromosome 3 (position 4609628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGATGTTACAGACCAATCATTGTCTTCAGAGGATGAGACACAAATA[C/T]GAGCATTAGTCTTAGGKATTGTTGAGGAGACAGAAAGAACGATTCTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/quvhk1p4