BRWD1

Ensembl ID:
ENSDARG00000074747
Description:
bromodomain and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:12760]
Human Orthologue:
BRWD1
Human Description:
bromodomain and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:12760]
Mouse Orthologue:
Brwd1
Mouse Description:
bromodomain and WD repeat domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1890651]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22585 Essential Splice Site Available for shipment Available now
sa17808 Nonsense Available for shipment Available now
sa32013 Nonsense Available for shipment Available now
sa42482 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24974 Nonsense Mutation detected in F1 DNA During 2016
sa2820 Nonsense F2 line generated During 2016
sa13081 Nonsense Available for shipment Available now
sa35805 Nonsense Mutation detected in F1 DNA During 2016
sa35804 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Essential Splice Site 28 2008 1 36
Genomic Location (Zv9):
Chromosome 15 (position 5775720)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5894057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGTACTGTATCGCCTTTGATCGAACAGGTTCCAGGATTTTTACGG[T/C]GAGCATCAAAAATCTGTTGGACTTCCCTGGGCCTTTGTTTTGGATCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 227 2008 7 36
Genomic Location (Zv9):
Chromosome 15 (position 5762980)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5881317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTAGTCGAGATGGCACTGCCCGCATATGGAGACTGCATCAGAGACAT[C/T]AGTGGAAGAGCGTTTTATTGGACATGTCTGCCACTCTTCCAGGGTATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 306 2008 9 36
Genomic Location (Zv9):
Chromosome 15 (position 5762372)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5880709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCGCAGGGTCATGAGGCGGAGGTGTTTGTTTTGGAGCCGCATCCCTA[T/A]GACCCTCGCATCATGCTCTCTGCTGGTCATGATGGCAATGTCTTTGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Essential Splice Site 456 2008 11 36
Genomic Location (Zv9):
Chromosome 15 (position 5758905)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5877242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATTGCAGATGAGCATCTTGTTCCTCAACTTGGCTATGTTGCTACAAG[T/A]AAGTGTTGTCATAACAGTGTTGTCCATGTTTCTCTGTTGACTGCTTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 833 2008 20 36
Genomic Location (Zv9):
Chromosome 15 (position 5743643)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5861980
KASP Assay ID:
554-7870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTAATCTTTGACTTTTAAAATCATAAATCATGTTTTTTTTCCAGGAC[C/T]AAGAGTTTGTGAAAATAACAGGGATCAAATATGAAGTTTGCCCTCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2820
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1006 2008 24 36
ENSDART00000115034 Nonsense 1006 2008 24 36
Genomic Location (Zv9):
Chromosome 15 (position 5739046)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5857383
KASP Assay ID:
554-3264.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACAGGGGTCGGGAACAAGAGAGCSCRCGCATCATTGCAGGAATAGAG[C/T]AGCTTATGACTGTGGGTATGTTTGATTTTGCTATTACACTCTTTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1220 2008 30 36
Genomic Location (Zv9):
Chromosome 15 (position 5733082)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5851419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGACGTTTGTAAGGACATYAGGCTTATTTTTGCMAATGCTAAAGCCTA[T/A]ACRCCAAACAAACGGTCWAAGGTAATGCAAGCATATATTTAGTCTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1250 2008 31 36
Genomic Location (Zv9):
Chromosome 15 (position 5732911)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5851248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTGTCCGCATTTTTTGAGGAGAACATACGCAAAATAATTTCCGACTA[C/A]AAGACTGCCATCAAAAGTAGCTTGAAGCTACGGCGCAGTCAGAGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115034 Nonsense 1339 2008 33 36
Genomic Location (Zv9):
Chromosome 15 (position 5731070)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5849407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGTACTAATTTTTGCTTTAAACACAGGATCTGATCAGGACAGCAAA[C/T]AGTCTTTGAGTCAGTCAGATGAGGATGATGAACATTCGTCTTCATCACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link