kcnd1

Ensembl ID:
ENSDARG00000074746
ZFIN ID:
ZDB-GENE-081105-40
Description:
potassium voltage-gated channel subfamily D member 1 [Source:RefSeq peptide;Acc:NP_001119942]
Human Orthologue:
KCND1
Human Description:
potassium voltage-gated channel, Shal-related subfamily, member 1 [Source:HGNC Symbol;Acc:6237]
Mouse Orthologue:
Kcnd1
Mouse Description:
potassium voltage-gated channel, Shal-related family, member 1 Gene [Source:MGI Symbol;Acc:MGI:96671

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41128 Nonsense Mutation detected in F1 DNA During 2017
sa41129 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114765 Nonsense 75 632 1 6
ENSDART00000133985 Nonsense 75 632 2 7
Genomic Location (Zv9):
Chromosome 8 (position 10412921)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9829503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGATATCCCGACACTCTGCTGGGCAGCTCGGAAAAGGAGTTTTTCTA[C/A]AACGAGGACACTCAGGAGTATTTCTTCGACCGGGATCCAGAGATGTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114765 Nonsense 109 632 1 6
ENSDART00000133985 Nonsense 109 632 2 7
Genomic Location (Zv9):
Chromosome 8 (position 10413021)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9829603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACATTTTGAACTTCTACCGAACAGGCCGGCTTCACTACCCCCGGCAG[G/T]AGTGCATTCAGGCCTTCGACGAGGAGTTGGCGTTCTACGGCATCGTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link