ENSDARG00000074745

Ensembl ID:
ENSDARG00000074745
Human Orthologues:
COL9A1, COL9A2, COL9A3
Human Descriptions:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
Mouse Orthologues:
Col9a1, Col9a2, Col9a3
Mouse Descriptions:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22198 Nonsense Available for shipment Available now
sa10904 Essential Splice Site Available for shipment Available now
sa19050 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31901 Nonsense Available for shipment Available now
sa38914 Nonsense Mutation detected in F1 DNA During 2016
sa35399 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Nonsense 90 780 3 26
Genomic Location (Zv9):
Chromosome 13 (position 1611964)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1605266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCATCGCCACCTTTAAAGTGACCAAGGACACTGCTAAAACATCCTG[G/A]AATCTATGGCAAGTCAGTGACCCTGAAGGCCGAGATCAGGTCGGCCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Essential Splice Site 271 780 6 26
ENSDART00000103004 Essential Splice Site 271 780 6 26
Genomic Location (Zv9):
Chromosome 13 (position 1615428)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1608730
KASP Assay ID:
2260-5913.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAGGTCTGCCGGGGAATACAGGRGATCCMGGCCRACAGGGCAACTGG[G/T]TAAGAGTTCAGTCTGAAATCTCACACTATGGTGTAAGAGTTNNNAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Essential Splice Site 271 780 6 26
ENSDART00000103004 Essential Splice Site 271 780 6 26
Genomic Location (Zv9):
Chromosome 13 (position 1615428)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1608730
KASP Assay ID:
2260-5913.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGGTCTGCCGGGGAATACAGGAGATCCAGGCCGACAGGGCAACTGG[G/T]TAAGAGTTCAGTCTGAAATCTCACACTATGGTGTAAGAGTTAACAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Nonsense 280 780 7 26
Genomic Location (Zv9):
Chromosome 13 (position 1623699)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1617209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCAGACTGTGTGTTATTGCAGGGCCGACGTGGGAACACTGGAGATTA[T/G]GGGCACATAGGAGAAACTGGGCCTAAAGTGAGTGTCTCCTTTATGCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Nonsense 370 780 12 26
Genomic Location (Zv9):
Chromosome 13 (position 1626365)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1619875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTTCCCATTTCTTCTTGGAACAGGGAAGCGAAGGCTTACACGGAGCT[G/T]AAGGATCTCGAGGACCACGAGGCCACCAGGTATAAAACAGACTGGGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Essential Splice Site 449 780 17 26
Genomic Location (Zv9):
Chromosome 13 (position 1630878)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1624388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATATGTTTGCTTACTATATATACAGTAATGTGTTTGGACATTTGACTT[A/G]GGGTGAAAAAGGTGAACAAGGTCCTCCAGGAAACATGGGCCCTCCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Nonsense 751 780 26 26
Genomic Location (Zv9):
Chromosome 13 (position 1656787)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1650297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACRTCTGGATGCGCCTTGCTTAATGCTACTTTAAGCAGACCTCCACAA[C/T]AAGTGCCCGAGCAGRCGCCGCAACGAGCATCYCAACRGGCACCTCAACGR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link