ENSDARG00000074745

Ensembl ID:
ENSDARG00000074745
Human Orthologues:
COL9A1, COL9A2, COL9A3
Human Descriptions:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
Mouse Orthologues:
Col9a1, Col9a2, Col9a3
Mouse Descriptions:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22198 Nonsense Available for shipment Available now
sa10904 Essential Splice Site Available for shipment Available now
sa19050 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Nonsense 90 780 3 26
Genomic Location:
Chromosome 13 (position 1611964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCATCGCCACCTTTAAAGTGACCAAGGACACTGCTAAAACATCCTG[G/A]AATCTATGGCAAGTCAGTGACCCTGAAGGCCGAGATCAGGTCGGCCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Essential Splice Site 271 780 6 26
ENSDART00000103004 Essential Splice Site 271 780 6 26
Genomic Location:
Chromosome 13 (position 1615428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAGGTCTGCCGGGGAATACAGGRGATCCMGGCCRACAGGGCAACTGG[G/T]TAAGAGTTCAGTCTGAAATCTCACACTATGGTGTAAGAGTTNNNAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Essential Splice Site 271 780 6 26
ENSDART00000103004 Essential Splice Site 271 780 6 26
Genomic Location:
Chromosome 13 (position 1615428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGGTCTGCCGGGGAATACAGGAGATCCAGGCCGACAGGGCAACTGG[G/T]TAAGAGTTCAGTCTGAAATCTCACACTATGGTGTAAGAGTTAACAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103004 Nonsense 751 780 26 26
Genomic Location:
Chromosome 13 (position 1656787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACRTCTGGATGCGCCTTGCTTAATGCTACTTTAAGCAGACCTCCACAA[C/T]AAGTGCCCGAGCAGRCGCCGCAACGAGCATCYCAACRGGCACCTCAACGR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w1gzuz23