si:dkey-116g14.1

Ensembl ID:
ENSDARG00000074739
ZFIN ID:
ZDB-GENE-070912-352
Description:
Novel protein similar to vertebrate SLIT and NTRK-like family, member 3 (SLITRK3) [Source:UniProtKB/
Human Orthologue:
SLITRK3
Human Description:
SLIT and NTRK-like family, member 3 [Source:HGNC Symbol;Acc:23501]
Mouse Orthologue:
Slitrk3
Mouse Description:
SLIT and NTRK-like family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2679447]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10873 Nonsense Available for shipment Available now
sa39881 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110447 Nonsense 488 875 3 4
ENSDART00000140844 Nonsense 498 882 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36537473)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36834183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGAGATACGAGAAATCCAGCCCGCTGCCTTCAGTTTAATGCCCTCCT[T/A]GCAGCTAGTCTTTCTCAACAAMAACCTCTTGCGAACGTTGCCCATGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110447 Nonsense 717 875 3 4
ENSDART00000140844 Nonsense 727 882 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36536787)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36833497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTGCACCCTCCTCGCATATGTGCAGCAACACCGTTTACAAAAGCGGA[C/T]AGGAGGAGTCAGGGCAGAAGCATCCATTCTCAGAGACAAAAGAGAGTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link