RSF1 (2 of 3)

Ensembl ID:
ENSDARG00000074737
Description:
remodeling and spacing factor 1 [Source:HGNC Symbol;Acc:18118]
Human Orthologue:
RSF1
Human Description:
remodeling and spacing factor 1 [Source:HGNC Symbol;Acc:18118]
Mouse Orthologue:
Rsf1
Mouse Description:
remodeling and spacing factor 1 Gene [Source:MGI Symbol;Acc:MGI:2682305]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43181 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112648 Essential Splice Site 224 1263 5 16
Genomic Location (Zv9):
Chromosome 18 (position 47286078)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2980057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCAAGACGCTCCCACCAGCCCAAATATGGAGACAGAAGGTGTTAAAG[G/A]TAAAAATCTTTGGAAGATTACTTCCTTTAAGTGCTAGAGATATTAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link