C0H5V7_DANRE

Ensembl ID:
ENSDARG00000074731
Description:
Collagen type XXVIII alpha 1 b [Source:UniProtKB/TrEMBL;Acc:C0H5V7]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10206 Essential Splice Site Available for shipment Available now
sa9159 Nonsense Mutation detected in F1 DNA During 2014
sa14346 Essential Splice Site Available for shipment Available now
sa1042 Nonsense F2 line generated During 2014
sa11556 Nonsense Available for shipment Available now
sa16583 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079675 None None 806 None 24
ENSDART00000113637 Essential Splice Site 35 491 1 17
Genomic Location:
Chromosome 6 (position 3446367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGTAAAAGTAAACCAATCACCTCAAATGTGATCCCCAAAAACAAAGG[T/G]AAATATCACATGCTCTTCAGCACAAATGCTWTTTAAAACMCTCATTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079675 None None 806 None 24
ENSDART00000113637 Nonsense 53 491 2 17
Genomic Location:
Chromosome 6 (position 3448391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACTGTAATTTGGAACTGGCRTTTTTGGTGGACAGCTCTGAAAGTGCC[A/T]AAGACAACCATGGCCAGGAGAAGAGCTTCGTTACTGATCTTGTCAACCRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079675 None None 806 None 24
ENSDART00000113637 Essential Splice Site 264 491 5 17
Genomic Location:
Chromosome 6 (position 3464235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGGTCGTCCTGGAGATGACGGAAGTCCAGGCCCTAAAGGTCAAAAGG[T/C]CAGAGTTTWCTAAAACAACCATAAATAATTCAGAAATAATGTGTCMMCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1042
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079675 Nonsense 670 806 22 24
ENSDART00000113637 None None 491 None 17
Genomic Location:
Chromosome 6 (position 3482299)
KASP Assay ID:
554-0945.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATGGTAACGGCGGGCATAATTTCGACACCAGCACATATAAAGGCAGC[A/T]GAGAAAACACAGGAACACCGTCTGCCACCAACACYGTGATCACTGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079675 Nonsense 701 806 22 24
ENSDART00000113637 None None 491 None 17
Genomic Location:
Chromosome 6 (position 3482392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGAGAGGCAGAGGAGGCACGTTTGCTTCAACAGCTGGTCCAGACATT[A/T]AACAGGTTAGTGCAGACATGATTATGAAATGAGCYTTTGGTTTGTGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079675 Nonsense 783 806 24 24
ENSDART00000113637 None None 491 None 17
Genomic Location:
Chromosome 6 (position 3485204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAGCTGCTCCTGGATCAGGGWCCTTGTCGAGAATATAACATYCGATG[G/A]TACTAYGTACCACAAGCCAACGCCTGTGCACAGTTCTGGTACGGTGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xr1gd441