C14orf102

Ensembl ID:
ENSDARG00000074726
Description:
chromosome 14 open reading frame 102 [Source:HGNC Symbol;Acc:20186]
Human Orthologue:
C14orf102
Human Description:
chromosome 14 open reading frame 102 [Source:HGNC Symbol;Acc:20186]
Mouse Orthologue:
BC002230
Mouse Description:
cDNA sequence BC002230 Gene [Source:MGI Symbol;Acc:MGI:2670969]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10370 Nonsense Available for shipment Available now
sa15076 Nonsense Available for shipment Available now
sa32154 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114927 Nonsense 421 1168 9 17
Genomic Location (Zv9):
Chromosome 17 (position 26575911)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26715830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAACTAGTGTTCATTCATCCAAAYAGCGCACCTTTATGGAAGAAGTA[T/G]CTGCTCTTCACACAGAGCCATTTCAGCACCTTCTCAGTGTCTAAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114927 Nonsense 1037 1168 14 17
Genomic Location (Zv9):
Chromosome 17 (position 26586968)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26726887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGGTTCTTTYACAGCATGGCAAAGAAAACTGASAGTGTTGTGCCGTA[T/A]CTCTTCGCCATCACTGCAGAACAACGTCTTAAACAGTTGCTGGACTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114927 Nonsense 1099 1168 15 17
Genomic Location (Zv9):
Chromosome 17 (position 26589079)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26728998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACAGGAACAGAGCATGGAGCCCACTGTCCTCTGCTGTGGAGAATGTA[T/A]CTGAACTTCATGGTAAAGTTGTAAACAGTGCATTTTAGAAGTGTTTATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link