C14orf102

Ensembl ID:
ENSDARG00000074726
Description:
chromosome 14 open reading frame 102 [Source:HGNC Symbol;Acc:20186]
Human Orthologue:
C14orf102
Human Description:
chromosome 14 open reading frame 102 [Source:HGNC Symbol;Acc:20186]
Mouse Orthologue:
BC002230
Mouse Description:
cDNA sequence BC002230 Gene [Source:MGI Symbol;Acc:MGI:2670969]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10370 Nonsense Available for shipment Available now
sa15076 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114927 Nonsense 421 1168 9 17
Genomic Location:
Chromosome 17 (position 26575911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAACTAGTGTTCATTCATCCAAAYAGCGCACCTTTATGGAAGAAGTA[T/G]CTGCTCTTCACACAGAGCCATTTCAGCACCTTCTCAGTGTCTAAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114927 Nonsense 1037 1168 14 17
Genomic Location:
Chromosome 17 (position 26586968)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGGTTCTTTYACAGCATGGCAAAGAAAACTGASAGTGTTGTGCCGTA[T/A]CTCTTCGCCATCACTGCAGAACAACGTCTTAAACAGTTGCTGGACTCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mnfw4rfs