ENSDARG00000074723

Ensembl ID:
ENSDARG00000074723
Human Orthologue:
MYO10
Human Description:
myosin X [Source:HGNC Symbol;Acc:7593]
Mouse Orthologue:
Myo10
Mouse Description:
myosin X Gene [Source:MGI Symbol;Acc:MGI:107716]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10569 Essential Splice Site Available for shipment Available now
sa20661 Essential Splice Site Mutation detected in F1 DNA During 2014
sa728 Nonsense Available for shipment Available now
sa5354 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8222 Nonsense Mutation detected in F1 DNA During 2014
sa11662 Essential Splice Site Available for shipment Available now
sa15852 Nonsense Available for shipment Available now
sa20660 Nonsense Available for shipment Available now
sa17425 Nonsense Available for shipment Available now
sa13802 Nonsense Available for shipment Available now
sa14730 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Essential Splice Site 605 1997 17 44
Genomic Location:
Chromosome 6 (position 11049150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCCAAYCCCTTCTTTGTGCGTTGCATCAAACCAAACATGGACAAA[G/A]TGAGAGCAGTTACAKCACCCAATAACAACYGCATGCCATTMAACACRANNNGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Essential Splice Site 778 1997 21 44
Genomic Location:
Chromosome 6 (position 11044188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGAAGCACAGGAGAGGGCAAGTGGCAAGAGGAGTCTGCCGTAAACT[A/G]CGAGACGAGAAGAAGAAGAGAGAGGAGGAGGAAAGGAAAAAGAAAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Nonsense 805 1997 23 44
Genomic Location:
Chromosome 6 (position 11042940)
KASP Assay ID:
554-0635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATRGGTGCCCTTTAAATTCCATGYATGCCAGCTGTTTRTGTATTTTAAGG[C/T]AAAATAACCTTGAAGTCACCATTACTGTATGTAATTAGTGTTNNGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Essential Splice Site 830 1997 25 44
Genomic Location:
Chromosome 6 (position 11040903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCCAGAATCGTGCAGCTCTTAGCTAAGCTTGAACAAATTCATTATACT[G/A]TAATTTTGCTGTCACACTGMATTCTCTTTTATATGTAAATTTCTAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Nonsense 898 1997 26 44
Genomic Location:
Chromosome 6 (position 11040417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCCTGCGACAGAAAAAAGCAGCATCTCGTGTGGCCACTGAATTCCTT[G/T]AACTCCTTGACACTGGAGGCCCWGAAGTCATCCCTGGGGATCCTAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Essential Splice Site 1069 1997 27 44
Genomic Location:
Chromosome 6 (position 11039810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATCCTACAACCGCAGCTCAGATTCAGTACGKTACWCAAAGACTRTGG[G/A]TCTGACAACAATCATTCTTAAAGCTTAAGGTGGACGYAATATGTGMATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Nonsense 1265 1997 33 44
Genomic Location:
Chromosome 6 (position 11033525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTTGACAGCTGGTTCTGCTCTCCTTCCCTCAGGGCACACTGGATGTY[G/T]GATTGATCGATTCGGTTTGTGCTTCAGACAATCCTGACCGGTGAGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Nonsense 1359 1997 35 44
Genomic Location:
Chromosome 6 (position 11031363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAAAAAGCGCTGGTTTGTCTTGACGCATAATTCTCTGGACTACTAC[A/T]AGTCTTCTGAACGCAATGCATCCAAGATGGGGACTCTGGTTCTAAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Nonsense 1454 1997 37 44
Genomic Location:
Chromosome 6 (position 11028620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTTNGYGATTTTGTGTAGGAAAACAGTGTTAATTCTGAAGCTGTGGAA[C/T]AAATGTATAGAAGAAACCCTATCCTGAGATACACCCAGCAWCCCTTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Nonsense 1595 1997 39 44
Genomic Location:
Chromosome 6 (position 11024010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTRAATAATCTCTCAGGGTYAGAGAGCGCTACCCTGGCACTGAGATT[G/T]AGAAGTATGCCCACTTTATTGGTGAGTCCCTGAARAAGACGAAGGCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113347 Nonsense 1924 1997 43 44
Genomic Location:
Chromosome 6 (position 11017202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATGATCTGTGGCTGGGYGTCAGTGCTGAAAATGTCKCGGTGTACAAA[C/T]GAGGTGAACCCAAACCCCTTGAAAYTTTCCAGTATGAGCACATTGTATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t50xgolu