si:ch1073-332b11.1

Ensembl ID:
ENSDARG00000074721
ZFIN ID:
ZDB-GENE-091204-470
Human Orthologue:
RASSF9
Human Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 [Source:HGNC Symbol;Acc:15739]
Mouse Orthologue:
Rassf9
Mouse Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 Gene [Source:MGI Symbol;Acc:MGI:23

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8505 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110278 Nonsense 142 434 2 2
ENSDART00000136479 Nonsense 118 410 1 1
Genomic Location (Zv9):
Chromosome 18 (position 15974640)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16326406
KASP Assay ID:
2261-2017.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCAAAAGGGCATCAAAGTCTCGAGGAGCGAGGTCTAAAAGATGGGAC[C/T]AAGGACCTGCACAGTACGCCAAGACWGTATCAGCAGASAAGCAAAAACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link