LOC100148906

Ensembl ID:
ENSDARG00000074712
Human Orthologue:
SERPINA10
Human Description:
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 [Source:HGNC Sy
Mouse Orthologues:
Gm46, Serpina10
Mouse Descriptions:
predicted gene 46 Gene [Source:MGI Symbol;Acc:MGI:2684892]
serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 G

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5295 Essential Splice Site F2 line generated During 2014
sa11968 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5295
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111180 Essential Splice Site 258 372 2 4
Genomic Location:
Chromosome 5 (position 30497249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATCTCTAGACAACACATTGAAAAGTGGAAGAGAAGTGCTTTTGAAAG[G/A]TTTCTTGTCTTCATCAATATTAAGAACATCTCGATTTTKTCATTCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111180 Essential Splice Site 258 372 3 4
Genomic Location:
Chromosome 5 (position 30497370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAATGGATTACCCAGTCATCTTTAACCAGTGACTTCTATTTTTCTTGC[A/T]GAAAAGTTGACATCTACRTCCCCAARCTTTCTCTGAAAACATCATACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/153f0do3