ARMC3

Ensembl ID:
ENSDARG00000074708
Description:
armadillo repeat containing 3 [Source:HGNC Symbol;Acc:30964]
Human Orthologue:
ARMC3
Human Description:
armadillo repeat containing 3 [Source:HGNC Symbol;Acc:30964]
Mouse Orthologue:
Armc3
Mouse Description:
armadillo repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:1918132]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18404 Essential Splice Site Available for shipment Available now
sa18333 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Essential Splice Site 98 867 3 18
Genomic Location:
Chromosome 24 (position 17614124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGCGCAGGAATGCTGTCATGGCTTTGGGCGTCATGGCTTCTAACAG[T/A]ACGTAGGGTTTAAAAATAGGCACAGTAAGTAAATCAAAAGATTTTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Nonsense 145 867 5 18
Genomic Location:
Chromosome 24 (position 17612031)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCACATTGTGTTTGGCATCATTGTCAGTGGACTTCTCCTACAAGATC[C/T]AGATATTTGAAAGCAATGGACTTGAACCTCTTATTCAGCTCTTGTCCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0yebjtki