ARMC3

Ensembl ID:
ENSDARG00000074708
Description:
armadillo repeat containing 3 [Source:HGNC Symbol;Acc:30964]
Human Orthologue:
ARMC3
Human Description:
armadillo repeat containing 3 [Source:HGNC Symbol;Acc:30964]
Mouse Orthologue:
Armc3
Mouse Description:
armadillo repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:1918132]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18404 Essential Splice Site Available for shipment Available now
sa44113 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18333 Nonsense Available for shipment Available now
sa32483 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Essential Splice Site 98 867 3 18
ENSDART00000111237 Essential Splice Site 98 867 3 18
Genomic Location (Zv9):
Chromosome 24 (position 17614124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16920600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTGCGCAGGAATGCTGTCATGGCTTTGGGCGTCATGGCTTCTAACAG[T/A]ACGTAGGGTTTAAAAATAGGCACAGTAAGTAAATCAAAAGATTTTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Essential Splice Site 98 867 3 18
ENSDART00000111237 Essential Splice Site 98 867 3 18
Genomic Location (Zv9):
Chromosome 24 (position 17614124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16920600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGCGCAGGAATGCTGTCATGGCTTTGGGCGTCATGGCTTCTAACAG[T/C]ACGTAGGGTTTAAAAATAGGCACAGTAAGTAAATCAAAAGATTTTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Nonsense 145 867 5 18
Genomic Location (Zv9):
Chromosome 24 (position 17612031)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16918507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCACATTGTGTTTGGCATCATTGTCAGTGGACTTCTCCTACAAGATC[C/T]AGATATTTGAAAGCAATGGACTTGAACCTCTTATTCAGCTCTTGTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111237 Essential Splice Site 179 867 5 18
Genomic Location (Zv9):
Chromosome 24 (position 17611926)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16918402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCAGATGTGAAGAAAAACTCAGTGGAGTGCATCTTTAATCTAGTGCAA[G/A]TAAGACAACAGATTAGTCAGAGTCAGTCAGAAAGTTTGCTGTGATTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link