LOC100332589

Ensembl ID:
ENSDARG00000074705
Mouse Orthologue:
Mprip
Mouse Description:
myosin phosphatase Rho interacting protein Gene [Source:MGI Symbol;Acc:MGI:1349438]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14261 Essential Splice Site Available for shipment Available now
sa17524 Nonsense Available for shipment Available now
sa11649 Nonsense Available for shipment Available now
sa44190 Nonsense Mutation detected in F1 DNA During 2016
sa24557 Essential Splice Site Available for shipment Available now
sa24558 Nonsense Mutation detected in F1 DNA During 2016
sa12641 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110538 Essential Splice Site 456 2467 7 24
Genomic Location (Zv9):
Chromosome 24 (position 40902559)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39390312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCCCTGGCAGAGAGGAGGTGGAGCGGCTGTTCGGATGCCAGCGAAG[G/A]TGATTAGCATTWACACATAAAGGCTCTGTTTCAAATTTAAGTGAGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110538 Nonsense 1084 2467 16 24
Genomic Location (Zv9):
Chromosome 24 (position 40937002)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39424755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGGAGGCCAGTTTGCTWGAGAAGAATCARGAGCTGAGGCAGCTGGAG[C/T]AGMAGCAAGCTTTACAAAGGGACCAGCACAGAGAGATGCAGAGGTTRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110538 Nonsense 1430 2467 16 24
Genomic Location (Zv9):
Chromosome 24 (position 40938042)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39425795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTAAAGCGACAGAGGATTCGCTTWTCCACTATCCAGTGCCAAACCTA[C/A]CACCGGTCCCAGGGAGCAGACAAGTTTCAGAMAGAAAACACATCTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110538 Nonsense 2005 2467 16 24
Genomic Location (Zv9):
Chromosome 24 (position 40939765)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39427518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGCAGAACCTGTCCCAGCTGGAAGAAGCATTTCATAGGGAGAAAGAA[G/T]AGCTGAAGTGCAAACATGCAGATGAATTTGGAAGGGCAGAGCAGGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110538 Essential Splice Site 2160 2467 16 24
Genomic Location (Zv9):
Chromosome 24 (position 40940233)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39427986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGACCAGCCTGAGGGAAAAGTACCAGCGAGACTTGGACAGTCTCAAG[G/T]TTTTACTTTTGATTTTTCAGATTTAGCGTCACACCCATTTACCTCCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110538 Nonsense 2272 2467 19 24
Genomic Location (Zv9):
Chromosome 24 (position 40945455)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39433208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTTTTGTCTGAGCAGTATTCTCAGAAGTGTCTGGAAAACGCACATT[T/A]GGCTCAAGCGCTGGAAGCTGAGAGACAGGCGCTGGGACAGTGTCAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110538 Nonsense 2338 2467 21 24
Genomic Location (Zv9):
Chromosome 24 (position 40948004)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39435757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCTTTGACTCRTTGKATGGAAACGCTGSTTTATTYACACAGGTTTTGCTA[C/T]GAGTGAAGGAGTCCGAGATCCAGTACCTCAAACAAGAAATAAACTCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link