LOC793800

Ensembl ID:
ENSDARG00000074703
Human Orthologue:
CCDC97
Human Description:
coiled-coil domain containing 97 [Source:HGNC Symbol;Acc:28289]
Mouse Orthologue:
Ccdc97
Mouse Description:
coiled-coil domain containing 97 Gene [Source:MGI Symbol;Acc:MGI:1196455]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33267 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099754 Nonsense 231 361 4 6
Genomic Location (Zv9):
Chromosome 3 (position 39957794)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39821154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACATCGGTCAGTACCTTAGCGAAGAAGAGATCCTGCAGCGCTCAGAG[G/T]AGGTCATGAGGAGCGGTACAGGAGGACTCGCTGACCTCCTTATCGACTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link