si:dkey-192i18.4

Ensembl ID:
ENSDARG00000074702
ZFIN ID:
ZDB-GENE-090312-50
Human Orthologue:
ARFGEF2
Human Description:
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) [Source:HGNC Sy
Mouse Orthologue:
Arfgef2
Mouse Description:
ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9158 Nonsense Mutation detected in F1 DNA During 2017
sa14736 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111852 Nonsense 1262 1846 27 40
ENSDART00000140866 Nonsense 1252 1832 27 39
Genomic Location (Zv9):
Chromosome 23 (position 19294798)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19079905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCATGTGTTATCAGGTCGCCCACTATCCGGGACATGGTGATACGKTG[T/A]GTGGCCCAGATGGTCAACTCTCAGGCTGCTAATATTCGCTCTGGCKGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111852 Essential Splice Site 1362 1846 28 40
ENSDART00000140866 Essential Splice Site 1352 1832 28 39
Genomic Location (Zv9):
Chromosome 23 (position 19294390)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19079497
KASP Assay ID:
2261-7539.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTCGGCTAATTCGCCACTGTGCTAAATATGTGTCTGAAAGGCCGCAG[G/A]TGAGTGTCAGTCTTAGATGCTCATAATGRTTAGGCTTTAAAKGCTATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link