LOC563642

Ensembl ID:
ENSDARG00000074698
Human Orthologue:
SDSL
Human Description:
serine dehydratase-like [Source:HGNC Symbol;Acc:30404]
Mouse Orthologue:
Sdsl
Mouse Description:
serine dehydratase-like Gene [Source:MGI Symbol;Acc:MGI:2182607]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42887 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7433 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108794 Essential Splice Site 58 329 1 7
Genomic Location (Zv9):
Chromosome 17 (position 14454507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14605335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCGCCGGTTCCTTCAAAATCCGTGGAATAGGATACATGTGTCAAAATG[T/A]GAGGAAAAATGTTGCTTGTTTCTAAAAGTTAAGAACCAAATTTCTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108794 Missense 93 329 3 7
Genomic Location (Zv9):
Chromosome 17 (position 14451905)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14602733
KASP Assay ID:
554-4080.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAATGGCCACAGCATATGCAGCAAGAAAACTYAACCTACCAGCCACTA[T/G]TGTTTTACCATTATCGAYACCTGAACTTGTWGCTCAGAAACTTAAAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link