mertk

Ensembl ID:
ENSDARG00000074695
ZFIN ID:
ZDB-GENE-081107-1
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JME4]
Human Orthologue:
MERTK
Human Description:
c-mer proto-oncogene tyrosine kinase [Source:HGNC Symbol;Acc:7027]
Mouse Orthologue:
Mertk
Mouse Description:
c-mer proto-oncogene tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:96965]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa561 Essential Splice Site Available for shipment Available now
sa22378 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15250 Essential Splice Site Available for shipment Available now
sa18550 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109266 Essential Splice Site 510 952 10 19
ENSDART00000142729 None None 150 None 2
ENSDART00000109266 Essential Splice Site 510 952 10 19
ENSDART00000142729 None None 150 None 2
Genomic Location:
Chromosome 13 (position 48134986)
KASP Assay ID:
554-0471.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATCGTGTTGTGTTGGGTGGTGTGGCTGCACAACAACTCTTATTTACC[G/A]TAAGCTCATTTCTTGTTTTCTCATTCAACATGAAATCTAAAGTAACGCGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109266 Essential Splice Site 510 952 10 19
ENSDART00000142729 None None 150 None 2
ENSDART00000109266 Essential Splice Site 510 952 10 19
ENSDART00000142729 None None 150 None 2
Genomic Location:
Chromosome 13 (position 48134986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATCGTGTTGTGTTGGGTGGTGTGGCTGCACAACAACTCTTATTTACC[G/T]TAAGCTCATTTCTTGTTTTCTCATTCAACATGAAATCTAAAGTAACGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109266 Essential Splice Site 706 952 16 19
ENSDART00000142729 None None 150 None 2
Genomic Location:
Chromosome 13 (position 48143613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCAGCAGAAACTTCCTYCACCGAGACCTGGCCGCACGAAACTGCATG[T/A]ATGTGTCCTCAACTTATAGTCTATTGACTAATTTAAAAATCGYGTGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109266 Essential Splice Site 706 952 17 19
ENSDART00000142729 None None 150 None 2
Genomic Location:
Chromosome 13 (position 48146239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCYTCTAAGTGTCAGNNTANTTTTTTTATGCATGTTGTGTTTGTTTTGTCT[A/C]GGTTGCGTGATGACATGAGYGTGTGTGTTGCTGATTTCGGCTTGTCAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/epnhle2u