mms22l

Ensembl ID:
ENSDARG00000074691
ZFIN ID:
ZDB-GENE-030131-3869
Description:
Uncharacterized protein C6orf167 homolog [Source:UniProtKB/Swiss-Prot;Acc:B3DIY3]
Human Orthologue:
MMS22L
Human Description:
MMS22-like, DNA repair protein [Source:HGNC Symbol;Acc:21475]
Mouse Orthologue:
F730047E07Rik
Mouse Description:
RIKEN cDNA F730047E07 gene Gene [Source:MGI Symbol;Acc:MGI:2684980]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36192 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36191 Nonsense Mutation detected in F1 DNA During 2016
sa42766 Nonsense Mutation detected in F1 DNA During 2016
sa22888 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110263 Essential Splice Site 238 1240 6 24
ENSDART00000134381 Essential Splice Site 238 1240 7 25
ENSDART00000143859   None 52 None 2

The following transcripts of ENSDARG00000074691 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 34616143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTGGTCTGTTCTAGAGATCCTGCACCTGTTGGAGCAAAGAATGATGG[G/A]TATGTTGCAATAGCCGGAAATGGGCTGAGATTGTGCTTGAATCTGGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110263 Nonsense 378 1240 9 24
ENSDART00000134381 Nonsense 378 1240 10 25
ENSDART00000143859   None 52 None 2

The following transcripts of ENSDARG00000074691 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 34615467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACACCTGGCCCAGATTGGGATGCACAACAGGAACGGCACTGCTCAA[C/T]AGGAGGTAGAGCAACACTGACCTGTATCCCATGATGAGATGTATATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110263 Nonsense 1086 1240 21 24
ENSDART00000134381 Nonsense 1086 1240 22 25
ENSDART00000143859   None 52 None 2

The following transcripts of ENSDARG00000074691 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 34599393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTGCAGAGAGAACTTCCTCCAGTTTAAAGGTCTCGCTCCTCCTCCT[C/T]GACTTGCAGCTGTTCTCTGTTTTCTGTTGGAGCTCCTGAAAAGGAACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110263 Essential Splice Site 1128 1240 22 24
ENSDART00000134381 Essential Splice Site 1128 1240 23 25
ENSDART00000143859   None 52 None 2

The following transcripts of ENSDARG00000074691 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 34596543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTATATTTCATTATTTTTATTTAATCAAATGCCTGTTATTTTTCTTCA[G/A]TAAAAAGGCTGAGCTCAGAGGTTACACAGCTCATTGTGGAGAGGTGCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link