PPM1J

Ensembl ID:
ENSDARG00000074690
Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1J [Source:HGNC Symbol;Acc:20785]
Human Orthologue:
PPM1J
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1J [Source:HGNC Symbol;Acc:20785]
Mouse Orthologue:
Ppm1j
Mouse Description:
protein phosphatase 1J Gene [Source:MGI Symbol;Acc:MGI:1919137]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33960 Nonsense Mutation detected in F1 DNA During 2017
sa25346 Nonsense Mutation detected in F1 DNA During 2017
sa10848 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110938 Nonsense 261 511 8 14
Genomic Location (Zv9):
Chromosome 6 (position 48378487)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48439234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTTCATCTCTACAGGATGACCTAATAGAGAAGGAGAAAGAGTCTTA[C/A]AGCATCTCCGGTGGCTGTTGTGCCTTGGTTGCAATCCACTTGATGGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110938 Nonsense 338 511 10 14
Genomic Location (Zv9):
Chromosome 6 (position 48376360)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48437107
KASP Assay ID:
554-7406.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCTGCTTGGGAATGAGTTTACACATATTGAATTCCCCAGACGAATC[C/T]AACACAAGGAACTCGGCAAGAAGATGCTCTTCAGAGACCACACCATGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110938 Nonsense 411 511 12 14
Genomic Location (Zv9):
Chromosome 6 (position 48374188)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48434935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAAGTGTACAACTCCAACATTTATATCAAACCCTTCCTGTCCTGCTG[T/A]CCAGAAGTGAGTATAGTGATCAACATTTATTAGAGAWGGAACAGTACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link