mgea5

Ensembl ID:
ENSDARG00000074686
ZFIN ID:
ZDB-GENE-030131-3208
Human Orthologue:
MGEA5
Human Description:
meningioma expressed antigen 5 (hyaluronidase) [Source:HGNC Symbol;Acc:7056]
Mouse Orthologue:
Mgea5
Mouse Description:
meningioma expressed antigen 5 (hyaluronidase) Gene [Source:MGI Symbol;Acc:MGI:1932139]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22244 Nonsense Available for shipment Available now
sa1615 Nonsense Available for shipment Available now
sa16573 Nonsense Available for shipment Available now
sa13579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111438 Nonsense 34 909 1 16
Genomic Location:
Chromosome 13 (position 11759324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCCAGTGCCAGTGGAAGCGGTTGCAGATACCCAGTGTCCAGTTGAC[G/T]AGCCCACCATCGAGATTGAGCGAACAGGCCGCAGGAAATTCATCACCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111438 Nonsense 212 909 6 16
Genomic Location:
Chromosome 13 (position 11757218)
KASP Assay ID:
554-1556.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCACTTCATTTTTCCTTTTCCTCAGAGTATTGTGGAACATTTTGTTA[T/A]CCAAATGTGTCACAATCGCCTTACCTGCGCACAATAGGTGAAAAGCTACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111438 Nonsense 420 909 9 16
Genomic Location:
Chromosome 13 (position 11755202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTYGCTGCATCCACCCTGGTCACTTCCACTACAGTGACCACAGTCTTC[C/T]AACAGCCCATCATGAGTCCGGTTTTGCCCCTTTCTGATGAACCACATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111438 Nonsense 634 909 10 16
Genomic Location:
Chromosome 13 (position 11754083)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTCTCAAACTCCGCCAACAGGACCATTCTTTATGACCTGTATCCCTA[T/A]ATCTGGGATATAAAGAGTATCATCTCAATGGTGAAATCATTTGTTCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hpa4h0t3