ENSDARG00000074684

Ensembl ID:
ENSDARG00000074684

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15633 Nonsense Available for shipment Available now
sa22546 Essential Splice Site Available for shipment Available now
sa32003 Essential Splice Site Available for shipment Available now
sa22545 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097827 Nonsense 117 549 3 15
Genomic Location (Zv9):
Chromosome 14 (position 49105978)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47183637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGACACACAAYGCCTTATAATGGGGCTGAAATCTACTGCGCAAGGGT[T/A]ACAGGTAGGACTCTCTTTTACTATTTAGGTGGTGACAGTTCACCMGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097827 Essential Splice Site 211 549 6 15
Genomic Location (Zv9):
Chromosome 14 (position 49102916)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47180575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTGCTCCTTCAGAACCAGAGTGGGCCTTTTTTCTACTTGTCCAAGG[T/G]CAGATCATTTTACTTGCTTAGAATTTCAACAGGTGTGATCATCGACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097827 Essential Splice Site 407 549 11 15
Genomic Location (Zv9):
Chromosome 14 (position 49097800)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47175459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTGAAGACATCACTGTGACCCCTAATGACCTGCTCATCATGCCTGCG[G/T]TCAGACAGAATCATCTGAAGATTCAACTTTACTTCATTTATGCAGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097827 Essential Splice Site 454 549 13 15
Genomic Location (Zv9):
Chromosome 14 (position 49096350)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47174009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGGAAGGTTGAGGATTCAGCAACAGCAGAGATATCCAGATCTCAGG[T/G]CAGTTATTAACAGTTCAGATAAAGTGAAAATGATTAGAAAATGTAATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link