ENSDARG00000074683

Ensembl ID:
ENSDARG00000074683

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2669 Nonsense Mutation detected in F1 DNA During 2014
sa4479 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112961 Nonsense 50 1130 3 17
Genomic Location:
Chromosome 12 (position 47063788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTATAAYATTACTGATGACTCCTGGAGAAAYATACAGCAAAKCCCATA[T/G]CAGTACTACACTGAACATGATGACACTCTTATTGAATGGAGCGGCTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112961 Nonsense 475 1130 7 17
Genomic Location:
Chromosome 12 (position 47055766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGCCTGGATGAGCCTTGGAGATCCACTGATAACTCTTATTTTTATTA[T/G]AATTATTANNNNNNNNNCTACTATAGCATGTGTGAYTATAATGTGGAGTGGAATGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rc6y08az