CLCN2 (1 of 2)

Ensembl ID:
ENSDARG00000074681
Description:
chloride channel 2 [Source:HGNC Symbol;Acc:2020]
Human Orthologue:
CLCN2
Human Description:
chloride channel 2 [Source:HGNC Symbol;Acc:2020]
Mouse Orthologue:
Clcn2
Mouse Description:
chloride channel 2 Gene [Source:MGI Symbol;Acc:MGI:105061]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30445 Nonsense Mutation detected in F1 DNA During 2017
sa30444 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089279 Nonsense 494 881 14 23
Genomic Location (Zv9):
Chromosome Zv9_NA428 (position 57160)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150171.1 57160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGCATCAACACAGACGGCACCATCTATCCCATAGTTCCCGGTGGATA[C/A]GCTGTTGTGGGTAAGAAACGCACACAAACATGGTGTGTGTGTGTGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089279 Essential Splice Site 751 881 20 23
Genomic Location (Zv9):
Chromosome Zv9_NA428 (position 37763)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150171.1 37763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTTCAGGATGATCCAGACGCAGAGGATGACATGACTCTTGGAGAGG[T/C]GAGGATATTGAAAACCTCTCGTAAATGATGTTGACACGCACACACATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link