si:dkey-14m15.1

Ensembl ID:
ENSDARG00000074680
ZFIN ID:
ZDB-GENE-090312-135
Description:
Novel protein similar to vertebrate regulating synaptic membrane exocytosis 1 (RIMS1) [Source:UniPro
Human Orthologue:
RIMS1
Human Description:
regulating synaptic membrane exocytosis 1 [Source:HGNC Symbol;Acc:17282]
Mouse Orthologue:
Rims1
Mouse Description:
regulating synaptic membrane exocytosis 1 Gene [Source:MGI Symbol;Acc:MGI:2152971]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35503 Nonsense Mutation detected in F1 DNA During 2017
sa1448 Essential Splice Site F2 line generated During 2017
sa35502 Nonsense Mutation detected in F1 DNA During 2017
sa8822 Nonsense Mutation detected in F1 DNA During 2017
sa42215 Nonsense Mutation detected in F1 DNA During 2017
sa42214 Nonsense Mutation detected in F1 DNA During 2017
sa35501 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42213 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Nonsense 327 1570 6 33
ENSDART00000131631 Nonsense 322 963 5 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035   None 182 None 5
ENSDART00000142568   None 442 None 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27909494)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27555154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCCTGAGACAAGGAGGACAGAGGGGGAGCAGAAACCACCCAGGGAA[C/T]AGTGCAGGACTGACCCAAACGCTCCACATCACCCGGGGAAACTCCGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1448
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Essential Splice Site 530 1570 7 33
ENSDART00000131631 Essential Splice Site 525 963 6 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035   None 182 None 5
ENSDART00000142568   None 442 None 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27906024)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27551684
KASP Assay ID:
554-1374.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGCAAATGTGTAAACTCTGGGAATTTTATGTGTGTTTGTGTGTTTT[A/G]GGGGACTGGGAGTGCTGTCCACTGGACCCCACTGCGTGGCATGTAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Nonsense 563 1570 8 33
ENSDART00000131631 Nonsense 558 963 7 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035   None 182 None 5
ENSDART00000142568   None 442 None 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27903606)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27549266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATGGCAGCCCTCCAAAGAAGGTGATCATTTAATTGGCCGAATCACTT[T/A]GAGCAAGAGAACAGCCATGCCAAAAGAGGCTGGGGCTCTGCTAGGGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Nonsense 598 1570 9 33
ENSDART00000131631 Nonsense 593 963 8 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035   None 182 None 5
ENSDART00000142568   None 442 None 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27903201)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27548861
KASP Assay ID:
2260-6483.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCGGGGGGAAGGTTACAGAAACTGGGAGACTTGGGGYCTTCATCACC[A/T]AAGTCAAGAAAGGAAGTCTAGCTGATGTAGTGGGTCATTTACGGGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Nonsense 662 1570 11 33
ENSDART00000131631 Nonsense 657 963 10 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035   None 182 None 5
ENSDART00000142568   None 442 None 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27899539)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27545199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAAAATATCTAATCTTTTTTTCATTCAGTGATATACCAAGAATACCA[G/T]AAACCTCACATCCTCCATTAGAATCAAGTATGTATTCAATCGAATGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Nonsense 782 1570 14 33
ENSDART00000131631 Nonsense 777 963 13 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035 Nonsense 39 182 2 5
ENSDART00000142568   None 442 None 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27898243)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27543903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTCTGGAGCCCAAGTGGAACCAGACGTTTGTGTACTCTCATGTCCAT[C/T]GACGGGACTTCAGAGAGCACATGCTGGAGATTACAGTGTGGGACCAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Essential Splice Site 1204 1570 27 33
ENSDART00000131631   None 963 None 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035   None 182 None 5
ENSDART00000142568 Essential Splice Site 76 442 3 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27875194)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27520854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCAAATCTAAAATGTTTACAAAGTTTCTGTGTAATTTATTCCATTA[G/T]CTTTATAAGGAGCAGCGAAGGAGTTGTGACAATGTGTCCCATAAGTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112553 Nonsense 1251 1570 27 33
ENSDART00000131631   None 963 None 17
ENSDART00000134494   None 56 None 2
ENSDART00000141035   None 182 None 5
ENSDART00000142568 Nonsense 123 442 3 9

The following transcripts of ENSDARG00000074680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27875052)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27520712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGCCTCGCGGATCAGTAGCACCAGCTACATGTCCATTCAATCAGAA[C/T]GACCCAGGGGTCGCTTTAGGTGAGATGCACGCTACAGCTATTATTACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link