frem3

Ensembl ID:
ENSDARG00000074677
ZFIN ID:
ZDB-GENE-030131-9788
Description:
Fras1 related extracellular matrix 3 [Source:RefSeq peptide;Acc:NP_001131131]
Human Orthologue:
FREM3
Human Description:
FRAS1 related extracellular matrix 3 [Source:HGNC Symbol;Acc:25172]
Mouse Orthologue:
Frem3
Mouse Description:
Fras1 related extracellular matrix protein 3 Gene [Source:MGI Symbol;Acc:MGI:2685641]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39642 Nonsense Mutation detected in F1 DNA During 2016
sa19528 Nonsense Available for shipment Available now
sa9807 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114228 Nonsense 140 3127 1 24
ENSDART00000142154 Nonsense 88 3075 1 24

The following transcripts of ENSDARG00000074677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 35361414)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 34921272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGTTCCCGGAGCCCAAGCAAAGACCACATAAAACTGCAACTGAGGTA[T/G]GACTCTAACACAGACACAGTGGTGGTCCCTTTAATTCTTGAAGTAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114228 Nonsense 1339 3127 1 24
ENSDART00000142154 Nonsense 1287 3075 1 24

The following transcripts of ENSDARG00000074677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 35357819)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 34917677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCAAGATGAACTGGACAAACAGTTGATTCAGTATGTTCACACAGGT[C/T]AGGAGGGTGTGCGTGACCTGCTAAAATTTGATGTCACTGATGGAATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114228 Essential Splice Site 2843 3127 None 24
ENSDART00000142154 Essential Splice Site 2791 3075 None 24

The following transcripts of ENSDARG00000074677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 35325879)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 34885737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGCTCGGTGGATTTTGGAGAGGGCACAGACACTGCCTTTATGGAAGG[T/C]ACTGAACAGCATTTTATTTTAACCTAATTTTAGGTGAAAGACCTAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link