frem3

Ensembl ID:
ENSDARG00000074677
ZFIN ID:
ZDB-GENE-030131-9788
Description:
Fras1 related extracellular matrix 3 [Source:RefSeq peptide;Acc:NP_001131131]
Human Orthologue:
FREM3
Human Description:
FRAS1 related extracellular matrix 3 [Source:HGNC Symbol;Acc:25172]
Mouse Orthologue:
Frem3
Mouse Description:
Fras1 related extracellular matrix protein 3 Gene [Source:MGI Symbol;Acc:MGI:2685641]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19528 Nonsense Mutation detected in F1 DNA During 2014
sa9807 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114228 Nonsense 1339 3127 1 24
ENSDART00000142154 Nonsense 1287 3075 1 24

The following transcripts of ENSDARG00000074677 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 35357819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCAAGATGAACTGGACAAACAGTTGATTCAGTATGTTCACACAGGT[C/T]AGGAGGGTGTGCGTGACCTGCTAAAATTTGATGTCACTGATGGAATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114228 Essential Splice Site 2843 3127 None 24
ENSDART00000142154 Essential Splice Site 2791 3075 None 24

The following transcripts of ENSDARG00000074677 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 35325879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGCTCGGTGGATTTTGGAGAGGGCACAGACACTGCCTTTATGGAAGG[T/C]ACTGAACAGCATTTTATTTTAACCTAATTTTAGGTGAAAGACCTAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v8ju5rfu