LOC556426

Ensembl ID:
ENSDARG00000074676
Human Orthologue:
RPRD2
Human Description:
regulation of nuclear pre-mRNA domain containing 2 [Source:HGNC Symbol;Acc:29039]
Mouse Orthologue:
Rprd2
Mouse Description:
regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36011 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112345 Nonsense 572 1095 9 9
Genomic Location (Zv9):
Chromosome 16 (position 1227411)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1176618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATTTTAAGCGGGAGAAAAGCAGAGAGTCGGAGAAGACAAAAGTCAAG[G/T]AAAAAGAAAGAGAAAAGAAAGAAAAGAAAGAGGCCGAAAGTGAGAGCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link