pan2

Ensembl ID:
ENSDARG00000074675
ZFIN ID:
ZDB-GENE-030131-3113
Human Orthologue:
PAN2
Human Description:
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20074]
Mouse Orthologue:
Pan2
Mouse Description:
PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111836 Essential Splice Site 495 1215 8 26
ENSDART00000140351 Essential Splice Site 495 1202 9 26
Genomic Location (Zv9):
Chromosome 23 (position 32233290)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32068180
KASP Assay ID:
554-1936.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGACGAGGAGCCACATCTTTACATGGTGCCAAAGAAATACAGGAAGG[T/C]AGTGATGAGCTATTGTTGTGCATAATCCTGTTCCGCATCATCCAAATAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link