pan2

Ensembl ID:
ENSDARG00000074675
ZFIN ID:
ZDB-GENE-030131-3113
Human Orthologue:
PAN2
Human Description:
PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20074]
Mouse Orthologue:
Pan2
Mouse Description:
PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45006 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa1948 Essential Splice Site Available for shipment Available now
sa45007 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa45006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111836 Splice Site, Nonsense 423 1215 7 26
ENSDART00000140351 Splice Site, Nonsense 424 1202 8 26
Genomic Location (Zv9):
Chromosome 23 (position 32232152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTTTGGGGATGTTTATGGATGTTGATGTGTTTGTTTCACTGTCAGA[C/T]GAGCGCCTCCAGTAGACCCAGAGATTCTGAGGACAATGAAAACTGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111836 Essential Splice Site 495 1215 8 26
ENSDART00000140351 Essential Splice Site 495 1202 9 26
Genomic Location (Zv9):
Chromosome 23 (position 32233290)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32068180
KASP Assay ID:
554-1936.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGACGAGGAGCCACATCTTTACATGGTGCCAAAGAAATACAGGAAGG[T/C]AGTGATGAGCTATTGTTGTGCATAATCCTGTTCCGCATCATCCAAATAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa45007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111836 Nonsense 1110 1215 24 26
ENSDART00000140351 Nonsense 1101 1202 24 26
Genomic Location (Zv9):
Chromosome 23 (position 32244479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAGCAAAAACAAATGTTGAAACCTTCACTTTTTAGGTCCCAAAAGAC[C/T]AGGTGATCGACACTGTCTACCTCTTTCACATGCCTAGGAAACGAATGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link