LOC100150489

Ensembl ID:
ENSDARG00000074672
Human Orthologues:
ERCC6, PGBD1, PGBD2, PGBD3, PGBD4
Human Descriptions:
excision repair cross-complementing rodent repair deficiency, complementation group 6 [Source:HGNC S
piggyBac transposable element derived 1 [Source:HGNC Symbol;Acc:19398]
piggyBac transposable element derived 2 [Source:HGNC Symbol;Acc:19399]
piggyBac transposable element derived 3 [Source:HGNC Symbol;Acc:19400]
piggyBac transposable element derived 4 [Source:HGNC Symbol;Acc:19401]
Mouse Orthologue:
Pgbd1
Mouse Description:
piggyBac transposable element derived 1 Gene [Source:MGI Symbol;Acc:MGI:2441675]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23578 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110925 Nonsense 285 374 1 2
Genomic Location:
Chromosome 19 (position 41101009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGGCTCCTCTATCGCCGTCATCTCACCCAGAAGCAGGAGAAGAAGTA[T/A]ATGCCACTTCTTGACTTCCGTGTTCAAGTTGCAGATGCCCTCATCAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k80r72x1