matk

Ensembl ID:
ENSDARG00000074670
ZFIN ID:
ZDB-GENE-070705-183
Description:
Novel protein similar to vertebrate megakaryocyte-associated tyrosine kinase (MATK) [Source:UniProtK
Human Orthologue:
MATK
Human Description:
megakaryocyte-associated tyrosine kinase [Source:HGNC Symbol;Acc:6906]
Mouse Orthologue:
Matk
Mouse Description:
megakaryocyte-associated tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:99259]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9981 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113521 Nonsense 244 438 7 11
Genomic Location:
Chromosome 22 (position 4682112)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTCTSTTTCTCCAGAAACCTCCATCATAAGAATCTGGTGCCGTTAT[T/G]AGGAGTTATTCTGCATAACGGGCTTCATATAGTCACRGAGTTAATGACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vz2fq9se