LOC794222

Ensembl ID:
ENSDARG00000074669
Human Orthologue:
CACNG4
Human Description:
calcium channel, voltage-dependent, gamma subunit 4 [Source:HGNC Symbol;Acc:1408]
Mouse Orthologue:
Cacng4
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859167]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40189 Nonsense Mutation detected in F1 DNA During 2016
sa18642 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112043 Nonsense 171 322 4 4
Genomic Location (Zv9):
Chromosome 3 (position 61573274)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60846966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCGGTATAATTGTCTACATCTCCAGCAATGCCGGCGACCCCAGCGAC[A/T]AAAGAGACGAGGACAAGAAGAATCAGTATAACTATGGTTGGTCGTTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112043 Nonsense 184 322 4 4
Genomic Location (Zv9):
Chromosome 3 (position 61573315)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60846925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGCGACAAAAGAGAYGAGGACAAGAAGAATCAGTATAACTATGGTTG[G/A]TCGTTCTACTTTGGAGCGCTCTCYTTCATTGTGGCYGAGGCRGTGGCYGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link