upf2

Ensembl ID:
ENSDARG00000074658
ZFIN ID:
ZDB-GENE-090715-1
Description:
UPF2 regulator of nonsense transcripts homolog (Yeast) [Source:UniProtKB/TrEMBL;Acc:C5J7W5]
Human Orthologue:
UPF2
Human Description:
UPF2 regulator of nonsense transcripts homolog (yeast) [Source:HGNC Symbol;Acc:17854]
Mouse Orthologue:
Upf2
Mouse Description:
UPF2 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2449307]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16959 Nonsense Available for shipment Available now
sa9599 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112432 Nonsense 85 1008 1 20
Genomic Location:
Chromosome 4 (position 873324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGAGAGGAAGAAGAAAGARGAGGAGAAGCAGAGAGCTGAGGARGAG[C/T]AGAGGAAGAAGGAGGAGGAGGAGAAGAAACRGCTGGRGGAACAGGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112432 Nonsense 397 1008 3 20
Genomic Location:
Chromosome 4 (position 869841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTATCCTGCACTCTAAAGGCGAGCTGAGCGAGGACAGACACAAGCAGTA[C/A]GAGGAGTTCGCCACACAGTACCAGAAGCTGCTGGCCAACACTCAGACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xq55nl3z