si:ch211-233m11.1

Ensembl ID:
ENSDARG00000074653
ZFIN ID:
ZDB-GENE-081028-16
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8A5N5]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7372 Missense Mutation detected in F1 DNA During 2017
sa10856 Nonsense Available for shipment Available now
sa9886 Essential Splice Site Available for shipment Available now
sa22201 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058017 Missense 391 766 1 7
ENSDART00000102758 Missense 391 704 1 3
ENSDART00000104483 Missense 388 822 1 8
ENSDART00000138143 Missense 400 528 1 1
Genomic Location (Zv9):
Chromosome 13 (position 2461746)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2705492
KASP Assay ID:
554-4120.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCTGGTATCAGRGMAGAGTTTTCTGCTTTGTTCATCTCAGCATTCAG[G/A]AGCATCTCGCAGCTCTAYATGTGCTGCTTTCATTCTCGCTGTACAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058017 Nonsense 468 766 2 7
ENSDART00000102758 Nonsense 476 704 1 3
ENSDART00000104483 Nonsense 473 822 1 8
ENSDART00000138143 Nonsense 485 528 1 1
Genomic Location (Zv9):
Chromosome 13 (position 2461490)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2705748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAATCAGATGCTCCTGAAAGGTCTTCTGACAMATYTTGGAAACATCW[C/A]ATTCAGTRAAGAGAAATCAACAGAGTACATTAAAAYAAGAATAAGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058017 Essential Splice Site 697 766 5 7
ENSDART00000102758   None 704 None 3
ENSDART00000104483 Essential Splice Site 753 822 6 8
ENSDART00000138143   None 528 None 1
Genomic Location (Zv9):
Chromosome 13 (position 2454667)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2712571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGTCTGATGGACTGAAGGATGCTCACTGCAAACTGGAGAAACTGAG[G/A]TGAGATCAGACATTAACCTTATCCAGATTAAATAAATAATTTTTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058017 Essential Splice Site 755 766 6 7
ENSDART00000102758   None 704 None 3
ENSDART00000104483 Essential Splice Site 811 822 7 8
ENSDART00000138143   None 528 None 1
Genomic Location (Zv9):
Chromosome 13 (position 2451685)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2715553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCTCTGATGTAAAAGATGATCCTAATTGTAAACTGGAGACACTGTG[G/A]TAAGTAGTAATCACTTGCATATTATATGATAATGTCATTTGAGCTACCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link