LOC571394

Ensembl ID:
ENSDARG00000074647
Human Orthologue:
GRIN3B
Human Description:
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B [Source:HGNC Symbol;Acc:16768]
Mouse Orthologue:
Grin3b
Mouse Description:
glutamate receptor, ionotropic, NMDA3B Gene [Source:MGI Symbol;Acc:MGI:2150393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31822 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114367 Essential Splice Site 562 777 4 9
Genomic Location (Zv9):
Chromosome 11 (position 14270910)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13959955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTATAATGTAATAAAAAGAGTGTAACTGTTTTTCCTGCCCTTGGCCTT[A/T]GCTTCATCACCCCTCTCAGGGATTCCGATTTGGCACAGTTCGGGAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link