ADAMTS16

Ensembl ID:
ENSDARG00000074646
Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 16 [Source:HGNC Symbol;Acc:17108]
Human Orthologue:
ADAMTS16
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 16 [Source:HGNC Symbol;Acc:17108]
Mouse Orthologue:
Adamts16
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16 Gene

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18552 Splice Site, Nonsense Available for shipment Available now
sa7774 Nonsense Mutation detected in F1 DNA During 2014
sa9951 Nonsense Available for shipment Available now
sa4631 Essential Splice Site F2 line generated During 2014
sa22737 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Splice Site, Nonsense 273 1224 5 23
Genomic Location:
Chromosome 16 (position 1150247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWMGTTAAATGCYTGASCGGGTGTTGATAWTGTCTTGATCCTGTTTCAGA[T/A]ATGCCCAAGCCTCCCGAGGAAGACATCTATATTTTTCCAGATGAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Nonsense 388 1224 7 23
Genomic Location:
Chromosome 16 (position 1158029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGATAAACCATCACGCTGACCACACGCTCAACAGTTTCTGTCAGTGG[C/T]AGTCGGGTTTATCAGGCCGAGAAGGACGCCGGCATGATCAYGCTATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Nonsense 564 1224 11 23
Genomic Location:
Chromosome 16 (position 1175822)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTTCTGTTGTGTGTCRCGCAGGACATCTGTAAAGCACTGTGGTGCCAT[C/T]GATTCGGGAGAAAATGTGAGACCAAGTTCATGCCGGCAGCCGAAGGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4631
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Essential Splice Site 861 1224 17 23
Genomic Location:
Chromosome 16 (position 1183921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGGTRTGGAGGAGTTATATATGCTAATTAGTGTGTTTCTCCTGCGC[A/T]GGTACTCCTGCAGGGCTGGAATCCAGGTGTGCAGTGGGAATATACACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Nonsense 1064 1224 20 23
Genomic Location:
Chromosome 16 (position 1198059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGATCTGCTTCATCAAACACTGCAGAAAACAGCGCAAGGCTCAGTG[G/A]TTCGTCTCCACATGGACACCGGTGAGAAAGACACACACAACGCACCGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/etr5gomn