ADAMTS16

Ensembl ID:
ENSDARG00000074646
Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 16 [Source:HGNC Symbol;Acc:17108]
Human Orthologue:
ADAMTS16
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 16 [Source:HGNC Symbol;Acc:17108]
Mouse Orthologue:
Adamts16
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16 Gene

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36010 Nonsense Mutation detected in F1 DNA During 2016
sa18552 Splice Site, Nonsense Available for shipment Available now
sa9951 Nonsense Available for shipment Available now
sa39072 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa4631 Essential Splice Site F2 line generated During 2016
sa22737 Nonsense Mutation detected in F1 DNA During 2016
sa39073 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Nonsense 152 1224 3 23
Genomic Location (Zv9):
Chromosome 16 (position 1129364)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1078571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGCTGGATGGAGAGATGATGTGTTTCTATCAGGGGGAGCTGAGGATG[C/T]AGGAACACTCCTCTGTGGCTCTGTCCACATGCATGGGGATGGTGAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Splice Site, Nonsense 273 1224 5 23
Genomic Location (Zv9):
Chromosome 16 (position 1150247)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1099454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWMGTTAAATGCYTGASCGGGTGTTGATAWTGTCTTGATCCTGTTTCAGA[T/A]ATGCCCAAGCCTCCCGAGGAAGACATCTATATTTTTCCAGATGAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Nonsense 564 1224 11 23
Genomic Location (Zv9):
Chromosome 16 (position 1175822)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1125029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTTCTGTTGTGTGTCRCGCAGGACATCTGTAAAGCACTGTGGTGCCAT[C/T]GATTCGGGAGAAAATGTGAGACCAAGTTCATGCCGGCAGCCGAAGGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Splice Site, Nonsense 737 1224 14 23
Genomic Location (Zv9):
Chromosome 16 (position 1179964)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1129171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGCTCTGCGCACAGGACAGCACCGACGTCTGCATCGACGGCATTTGT[G/T]AGGTATTGTGCACTATTCACATAGTTCACTCGGACACAAAGCAGACAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4631
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Essential Splice Site 861 1224 17 23
Genomic Location (Zv9):
Chromosome 16 (position 1183921)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1133128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGGTRTGGAGGAGTTATATATGCTAATTAGTGTGTTTCTCCTGCGC[A/T]GGTACTCCTGCAGGGCTGGAATCCAGGTGTGCAGTGGGAATATACACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Nonsense 1064 1224 20 23
Genomic Location (Zv9):
Chromosome 16 (position 1198059)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1147266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGATCTGCTTCATCAAACACTGCAGAAAACAGCGCAAGGCTCAGTG[G/A]TTCGTCTCCACATGGACACCGGTGAGAAAGACACACACAACGCACCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092657 Nonsense 1198 1224 23 23
Genomic Location (Zv9):
Chromosome 16 (position 1199646)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1148853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATGTGTGTGCAGATGTGGTGTGTAAGGATCACTTCAGCTGGTGTTA[T/A]CTGGTGCCGCAGCACAGCGTCTGCAACCACAAGTTCTACGGGAAGCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link