LOC100331540

Ensembl ID:
ENSDARG00000074644
Human Orthologue:
SPOCK1
Human Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 [Source:HGNC Symbol;Acc:112
Mouse Orthologue:
Spock1
Mouse Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 Gene [Source:MGI Symbol;Acc:MGI:105371

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28231 Essential Splice Site Mutation detected in F1 DNA During 2015
sa19073 Essential Splice Site Mutation detected in F1 DNA During 2015
sa9838 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa28231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109378 Essential Splice Site 151 355 4 9
Genomic Location:
Chromosome 14 (position 2051995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGCAAACCGAGACCTGAAGACCAGCACCAGTGAAGCTGCACAAGGAC[G/T]TGAGTGTGTGTTTATTAATCACACAAATGAGTTCACAGCCAATGCTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109378 Essential Splice Site 226 355 5 9
ENSDART00000109378 Essential Splice Site 226 355 5 9
Genomic Location:
Chromosome 14 (position 2053509)
KASP Assay ID:
2260-7135.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACTGTCCAACAACGAGTGGTGCTACTGCTTCCAGAAACCCGATGG[T/C]GAGTTTGCAAAAAAGAGGTATAATAAATCACATAAGCTTATTGGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109378 Essential Splice Site 226 355 5 9
ENSDART00000109378 Essential Splice Site 226 355 5 9
Genomic Location:
Chromosome 14 (position 2053509)
KASP Assay ID:
2260-7135.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAACTGTCCAACAACGAGTGGTGCTACTGCTTCCAGAAACCCGATGG[T/C]GAGTTTGCAAAAMAGAGRTATAATAAATCACATAAGCTTATTGGGRTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fj32wpw5