LOC100331540

Ensembl ID:
ENSDARG00000074644
Human Orthologue:
SPOCK1
Human Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 [Source:HGNC Symbol;Acc:112
Mouse Orthologue:
Spock1
Mouse Description:
sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 Gene [Source:MGI Symbol;Acc:MGI:105371

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19073 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9838 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109378 Essential Splice Site 226 355 5 9
ENSDART00000109378 Essential Splice Site 226 355 5 9
Genomic Location:
Chromosome 14 (position 2053509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACTGTCCAACAACGAGTGGTGCTACTGCTTCCAGAAACCCGATGG[T/C]GAGTTTGCAAAAAAGAGGTATAATAAATCACATAAGCTTATTGGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109378 Essential Splice Site 226 355 5 9
ENSDART00000109378 Essential Splice Site 226 355 5 9
Genomic Location:
Chromosome 14 (position 2053509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAACTGTCCAACAACGAGTGGTGCTACTGCTTCCAGAAACCCGATGG[T/C]GAGTTTGCAAAAMAGAGRTATAATAAATCACATAAGCTTATTGGGRTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fj32wpw5