B0JZA9_DANRE

Ensembl ID:
ENSDARG00000074642
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B0JZA9]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22174 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114268 Essential Splice Site 418 623 8 11
Genomic Location (Zv9):
Chromosome 12 (position 47350905)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 46357184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCTGGTATTAAGATTTTATCAGGAGTTTATGTGTTCATTATTTAAAC[A/T]GCACTGTGCACAAGGTCCTCTCCAGTGGTGAAGGGGTTTATCAGGTGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link