si:dkey-210e6.2

Ensembl ID:
ENSDARG00000074638
ZFIN ID:
ZDB-GENE-081104-370
Description:
Novel protein similar to human and mouse lipoxygenase homology domains 1 (LOXHD1) [Source:UniProtKB/
Human Orthologue:
LOXHD1
Human Description:
lipoxygenase homology domains 1 [Source:HGNC Symbol;Acc:26521]
Mouse Orthologue:
Loxhd1
Mouse Description:
lipoxygenase homology domains 1 Gene [Source:MGI Symbol;Acc:MGI:1914609]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31624 Essential Splice Site Available for shipment Available now
sa41097 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109492 Essential Splice Site 402 597 9 12
ENSDART00000133456   None 646 None 10
ENSDART00000140793   None 1507 None 31
Genomic Location (Zv9):
Chromosome 8 (position 833693)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 700203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGAGAAGAAAGAAGACAAGAAGAAGAAGAAGAAGAGTAAGAAGAAGA[G/A]TGAGGATGATGATGAGGAGGAGGGTGGAGAGGAGATGCGGCAGGTGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109492 Nonsense 489 597 10 12
ENSDART00000133456   None 646 None 10
ENSDART00000140793 Nonsense 999 1507 21 31
Genomic Location (Zv9):
Chromosome 8 (position 830492)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 697002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCATCAACATCTACGGGGAAAACGGAGACACCGGCGAGCGGCGCCTC[A/T]GAAAGTCCAACCATATGAACAAGTTTGAGCGCGGACAGGTGAGCGGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link