KIAA0284 (2 of 2)

Ensembl ID:
ENSDARG00000074636
Description:
KIAA0284 [Source:HGNC Symbol;Acc:20362]
Human Orthologue:
KIAA0284
Human Description:
KIAA0284 [Source:HGNC Symbol;Acc:20362]
Mouse Orthologue:
AW555464
Mouse Description:
expressed sequence AW555464 Gene [Source:MGI Symbol;Acc:MGI:2145043]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6454 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6140 Essential Splice Site Mutation detected in F1 DNA During 2018
sa5898 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112183 Essential Splice Site 61 1370 3 20
Genomic Location (Zv9):
Chromosome 17 (position 1270415)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1822076
GRCz11 17 1567843
KASP Assay ID:
554-5277.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATCACTAAATACAGAAACTGGTCATTAGCAGATATTTTCCTTCAGTG[C/T]AGCTTCMGGCACTTMGGGTGTGTTTTAGTTGCTGTTAAACCCTTGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112183 Essential Splice Site 602 1370 12 20
Genomic Location (Zv9):
Chromosome 17 (position 1248455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1843946
GRCz11 17 1589678
KASP Assay ID:
554-3711.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTCCGAAGGTATGGAGACTTTGCTTTAGGGATNNNNNNNNATGGAATTTTTGACT[G/A]ATACTGATAACTCTTTAGATTTGATWGCTGATACATAGACTAATACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112183 Nonsense 944 1370 13 20
Genomic Location (Zv9):
Chromosome 17 (position 1247138)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1845263
GRCz11 17 1590995
KASP Assay ID:
554-3774.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAGTCCTGCTACACGGCAGTTTCCTGACACTGTCTCAGACCAGGAAT[C/A]AAGTTCTTTACCTTATAAAAAGTACACTATTCCTCTTCAGAAGGAAGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link